Author Archives: hannah

Extraktion von DNA aus Schnecken

30.07.2020

Malakazoologen sind diejenigen, die Schnecken bestimmen und untersuchen. Leider sind diese Zoologen bis heute eher Schnecken Leichenfledderer und “Häuslesammler”. Jetzt wollte ich aber unsere einheimischen Schnecken bestimmen und fotografieren, ohne diese irgendwie zu stören.
So kam mir die Idee, nach meinen umfassenden Untersuchungen mit dem Alpenveilchen, bei den Schnecken ebenso mit der DNA zu arbeiten.

Durch Recherche fand ich, dass es eine umfassende Datenbank auf NCBI gibt über 16S als Marker für verschiedene Schnecken (1).

In meinem Labor benutze ich grundsätzlich keine giftigen Chemikalien wie Phenol, Mecaptoethanol oder Chloroform, die man normaler Weise zum Aufreinigen von DNA verwendet. Deshalb habe ich ein Protokoll entwickelt, das für Schnecken funktioniert ohne diese auf irgend eine Weise zu verletzten oder diese Chemikalien zu verwenden.

Dann haben Schnecken viele Polysaccharide, sogenannte Mucopolysaccharide und auch Glycogen. Diese können die PCR stören oder auch die DNA zum scheren bringen. Wenn die DNA geschert ist, erkennt man dies an “Wölkchen” als PCR Produkt. Falls kein PCR Produkt erscheint, ist es auch möglich, dass die DNA nicht in Lösung ging und noch im Eppi klebt.

Ich habe ziemlich viel Zeit in dieses Protokoll investiert und will es hier gerne mit interessierten Menschen teilen.

Extraktion von DNA aus Schnecken ohne Phenol und ohne Chloroform

Schnecke auf Swab

Ausgangsmaterial ist ein Abstrich mit einem Wattestab (Swab).

Hierbei wird sich die Schnecke zurück ziehen, das macht aber nichts.

Dann kommt der Kopf vom Swab in ein Eppi. Ich schneide oft nur den Teil der Watte ab der mit der Schnecke in Berührung kam. Hier ist aber äußerste Vorsicht geboten, da eine Kontamination mit menschlicher DNA durchaus möglich ist.

Je Eppi nehme ich 800 µl WB Buffer, plus 20 µl DTT, plus 20 µl Proteinase K. Der Puffer mit der Watte kann hier bei -20° Grad weggefroren werden für eine spätere Extraktion.

WB Buffer

100 mM TrisHCl pH 7.6
5 mM EDTA
350 mM Sorbitol
1 % PVP 40
2 % CTAB
2 M Na Cl

Dieser Schritt ist für viele Schneckenarten essentiell!

Das Sorbitol verbindet sich mit den Mucopolysacchariden und das PVP Polyvinylpyrrolidone (molweight 40000) entfernt die Polyphenole.

Dies alles wird gut gemischt. Wenn das Eppi mit dem Puffer und der DNA erst aufgetaut werden soll, dann stelle ich dies kurz auf den Heizblock bei 60°C. Dann kommt der Waschschritt:

Das Eppi kommt bei 8000 rpm für 10 Minuten in die Zentrifuge.

Danach schwimmt wohl das Sorbitol mit den Mucopolysacchariden und das PVP mit den Polyphenolen oben und die DNA mit CTAB befindet sich unten.

Also pipettiert man diese oben weg. Dies mache ich nach Gefühl, so etwa die oberen 500 µl der Lösung kommen weg.

Auf die Watte und den unteren Teil kommt dann 800 µl EB, plus 50 µl SDS (10 %) plus 20 µl DTT, plus 20 µl Proteinase K.

EB Buffer

10 mM TrisHCl pH 7.6
10 mM KCl
10 mM MgCl2
400 mM NaCL
2 mM EDTA
1 % CTAB
1 % PVP40

CTAB Puffer löst man am besten über Nacht und nicht zu stark schütteln, schäumt! Das SDS im EB Puffer trübt den Puffer ein, ist aber kein Problem, im Heizblock wird der Puffer wieder klar.

Proteinase K

20 mg/ml in 100mM Tris pH 8,6, 6 mM CaCl2, 50% Glycerin. Lagern bei -20°C.

Proteinase K ist am meisten aktiv bei 65°C mit SDS und sollte mindestens 1x im Jahr neu angesetzt und alliquotiert werden.

DTT

1 g DTT in 6,5 ml H2O oder 1M. Aliquotieren und bei  -20°C lagern. DTT oxidiert schnell, deshalb lieber öfters neu machen. DTT ist ein Reduktionsmittel für Disulfidbindungen

Das Eppi mit EB, SDS, DTT, und Proteinase K wird vorsichtig gemischt und kommt bei 60°- 65°C für vier Stunden in den Heizblock. Ab- und an das Eppi bisschen bewegen und mischen, aber nicht zu doll, sonst kann die DNA scheren. Ich hatte es auch schon deutlich länger auf dem Heizblock und danach bei Raumtemperatur (2 Tage), ohne nennenswerte Verluste.

Nach dem Verdau werden 700 µl abpittetiert – diesmal möglichst von unten. Dies kommt mit 600 µl Isopropanol in ein neues Eppi und wird vorsichtig gemischt. Das alles bei Raumtemperatur! Dann wird die DNA 60 Sekunden bei 10 K rpm abzentrifugiert (gerne auch mehr, kann ich aber nicht). Nicht zu lange oder zu kalt, sonst kommt unerwünschtes irgendwas mit oder das Pellet lässt sich nur schwer wieder lösen.

Danach kann man das Pellet mit 70% kaltem EtOH waschen und trocknen. Ich trockne immer ein paar Stunden auf der Bench. Lösen tu ich es mit etwa 50 µl Bidest meist über Nacht auch auf der Bench.

Es ist wichtig eventuelle Reste der Proteinase K zu deaktivieren, da sonst die Taq verdaut wird! Deshalb erhitze ich hier die DNA nochmal etwa 10 Minuten bei 80 °C.

Falls die PCR später nicht funktioniert, kann das am ehesten an der DNA liegen. Natürlich nur, wenn man sich mit den Primern sicher ist. Hier empfiehlt sich eine positiv Kontrolle. Probleme mit der DNA kann z.B. von der Proteinase K kommen. Meiner Erfahrung nach kann man da mit der Konzentration und der Verdauzeit eher hoch gehen, als runter.  RNAse benutze ich meistens keine.

Dann wieder die Mucopolysaccharide, Polyphenole und auch Glycogen. Diese können die PCR stören oder auch die DNA zum scheren bringen. Wenn die DNA geschert ist, erkennt man dies an “Wölkchen” als PCR Produkt. Hier muss man nochmal alles neu machen. Vielleicht einen 2. Schritt mit dem WB einfügen. Falls kein PCR Produkt erscheint, ist es auch möglich, dass die DNA nicht in Lösung ging und noch im Eppi klebt.

1 lane 16 S PCR Produkt lane 2-4 “Wölkchen” mit gescherter DNA


PCR der 16S mitochondrialen rDNA von Schnecken

Die Primer sind alt bekannt und wurden 1991 von Palumbi veröffentlicht (2). Ich habe sie allerdings etwas modifiziert:

HM106f – CGGCCGCCTGTTTATCAAAAACAT
HM107r – GGAGCTCCGGTTTGAACTCAGATC

16S Produkt ist etwa 400 bp groß

PCR: 30 cycles mit annealing 56°C und Phusion Taq (NEB)

Die Bande wird ausgeschnitten, mit dem Monarch DNA kit von New England Labs aufgereinigt, bei GATC in Köln mit Primer HM103 sequenziert und die Sequenz mit NCBI Blast abgeglichen.

Hier das Ergebnis mit meinem ersten Versuch, der oben abgebildeten Posthornschnecke.


(1) Razkin et al., Molecular phylogeny of the western Palaearctic Helicoidea (Gastropoda, Stylommatophora). Molecular Phylogenetics and Evolution, Volume 83, Pages 99-117 (2015)

(2) Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., The Simple Fool’s Guide to PCR, Version 2.0. Department of Zoology, University of Hawaii, Honolulu, HI. (1991)

(3) Jean-René Arseneau, Royce Steeves, Mark Laflamme, Modified low-salt CTAB extraction of high-quality DNA from contaminant-rich tissues. Mol Ecol Resour (2017) DOI: 10.1111/1755-0998.12616

(4) Peter W. Inglis, Marilia de Castro R. Pappas, Lucileide V. Resende, Dario Grattapaglia, Fast and inexpensive protocols for consistent extraction of high quality DNA and RNA from challenging plant and fungal samples for high-throughput SNP genotyping and sequencing applications, PLOS one (2018) https://doi.org/10.1371/journal.pone.0206085

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


Baumschnecke

Arianta arbustorum

Die Baumschnecke wird auch Gefleckte Schnirkelschnecke oder Baumschnirkelschnecke genannt und ist noch relativ häufig.

Ähnlich wie auch die Bänderschnecken soll Arianta arbustorum durch Drosseln verbreitet werden.

Unsere hier war auf dem Weg neben dem Römerbad in Hüfingen zu finden.



Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Arianta arbustorum|26|42AF40
TAAGTTGACTTATAATTGAAGTCTAGAATGAATGAATATACGGGCAGCAACTGTCTCAAAAGTATTTTTGCTAATTTAGTTACCAAGTGCAAATACTTGAAGTTATAAAAAAGACGAGAAGACCCTAGAAACTTAATTAATTTTGTTGGGGCGACAGAATTACAATATAAACTAATTTTCTATTACAGGAAACGTAGGTGAAAGAGCAAGTTACTCTAGGGATAACAGCGTAATTTAATTTAAGTTTGCGACCTCGATGTTGGACTAGGTATAGTAGTTTTTA









Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Märzenschnecke

01.05.2020

Zebrina detrita

Die Märzenschnecke wird auch als Weiße Turmschnecke, Zebraschnecke oder Kaiserstuhlschnecke bezeichnet und gehört zur Familie der Vielfraßschnecken.

Die Märzenschnecke bevorzugt sonnige und trockene Standorte wie Magerrasen und Weinberge. Deshalb wurde sie im Kaiserstuhl von den Winzern nahezu ausgerottet.

Die Märzenschnecke wird in Deutschland als stark gefährdet angesehen und steht auf der Roten Liste Kategorie 2.

Unsere Märzenschnecke hier lebt auf dem Magerrasen am Hang vom Fürstenberg.

Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Zebrina detrita|24|42AF37
GTGCTATCCTGCCCGGTGATTTTGTTTAACGGCCGCAGTACTTTGACTGTGCTAAGGTAGCATAATCACTTGTCTTTTAAATGGGGACTGGAATGAAAGGATGTTTGGATTGAGGCTGTCTTCATACTACTTATATTAAATTGCTAAAGGGGTGAAAATTCCCCTAATGGAACATTAGACGAGAAGACCCTTAGAATTATTACAAAAATAGTGTTAACTATGAAGTGTTTGTTGGGGCAACAGGGTATTTATATAACATACTTATATATATATGTAAACAAGCAGATAATTTTATGCATGAATAATTACCTGAGGGATAACAGCATAATTTACTATAAGATTGTGACCTCGATGTTGGACTAAGGAGTTAACTTATTAGACGTAAGTTAAGATGGTTCTGTTCGAACCCTGTACCTTACATGATCTGAGTTCAGACCGG





Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


Sumpfschnecke

22.04.2020

Stagnicola palustris

Die Sumpfschnecke lebt überall in Europa in stehenden Gewässern und Flußauen mit reicher Vegetation. Sie bevorzugt einen pH-Wert um 7, mag Sümpfe und flache Abflüsse, verträgt aber auch periodisch austrocknende Gewässer.

Die hier sequenzierten und beschriebenen Sumpfschnecken sind von der Höhlensteinwiese, eine Überschwemmungswiese der Breg bei Hüfingen.

Die DNA der Sumpfschnecke ließ sich lange nicht sequenzieren. So habe ich oft einen Nematoden namens Nais communis gefunden. Es ist bekannt, dass Schnecken von viele Nematoden befallen sind. Ob diese in Symbiose oder als Schmarotzer in den Schnecken leben ist nicht bekannt. Ich behaupte hier mal dreist, dass Nais communis mit Stagnicola palustris friedlich in Symbiose lebt.

Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Stagnicola palustris|21|42AF34
TAGCAGGCCGCAGTACCTTGGACTGTGCGTAAGGTAGCATAATCAATTGGCTTTTAATTGAAGTCTGGAATGAAAGGGATAATAGGAAAAAACTGTCTCAGAAAAAACTATTTGAAATTATTTAGTAAGTGAAAATACTTATATTCAGAAAAAAGACGAGAAGACCCTTAGAATTTTTATTAATAGATTCAATTTATATAAATTTTATATTTTAGTTGGGGCGACTTTGAACCATTTAAACGTTTATTAAAATACTCAACATTAAGATTTAAAAGAGCAAATTAGCTTAGGGATAACAGCATAATTTTTTATAAAGTTTGTGACCTCGATGTTGGACTAGGAACTTAATGATTAACCGTCAATATAGATTGTTCTGTTCGAACAGAAACTCCTACATGATC




d

d

d

D

d

d

d

d

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Bernsteinschnecke

29.10.2019

Gemeine Bernsteinschnecke

Succinea putris

Die Succinaeidae haben große, dünnschalige Gehäuse.
In den Wutachflühen soll es zwei Arten der Bernsteinschnecke geben. Die andere Art ist deutlich dunkler und bis jetzt habe ich sie noch nicht gefunden.

Bernsteinschnecke

d

d

d

D

dlkjd

dd

d

d

d

d

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Strauchschnecke

22.10.2019

Genabelte Strauchschnecke

Fruticicola fruticum

Die Familie der Strauchschnecken wurde früher als Bradybaenidae, dann als Fruticicolidae und morgen vielleicht als Camaenidae bezeichnet.

Wie auch immer sie genannt wird, die Strauchschnecke ist in Mitteleuropa wohl die einzige Vertreterin.

Unsere hier kommt in den Wutachflühen vor.

d

d

d

D

dlkjd

dd

d

d

d

d

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Xerolenta obvia

22.10.2019

Heideschnecke

Neben dem Bahnhof waren hier früher wilde Brachflächen mit abertausenden Schnecken. Ein Stück nach dem anderen wurde zugebaut und die neuen Eigenheimbesitzer haben sich für Schottergärten entschieden. So wurde alles Leben dort ausgelöscht und es gibt leider nur ein winziges Ausweichquartier in Form einer alten Garageneinfahrt und ein einziger Nachbar, der Natur mag.

Auf diese Flächen sind einige wenige der Schnecken ausgewichen, aber leider auch dort im Verschwinden begriffen.



Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Die Sequenz der 16S mitochondrialen rDNA von Xerolenta obvia ist einmalig. Das heißt es läßt sich nichts gleiches momentan in der Datenbank finden. Deshalb nenne ich hiermit unsere Weiße Heideschnecke, die wohl jetzt ausgestorben ist: Bahnhofs Heideschnecke.

>Xerolenta obvia|12|42AF24
GGGCCCAATATTTCATGTGAGTATCTCCGCTCCTGGTATACTAATCAGCCGCAGTACCTTGACTGTGCTAAGGTAGCATAATCATTTGGCTTATAATTGAAGTCTGGTATGAAGGGATCAATGGGGAGCCTTTGTTTCCTCTATTTATTTCATAATTACTTATTATGTGAAGATACCTATATTTAAATATCACACGACAAGACCATACAAATTTGCTTTAATTTAATGAATTACAATATACCTGTTTGTTGAGGCGACTGAATAACCTTTAACTTATTTTATATAATTTGCACTATTTATTGTGAAAGATTAAATTACTCTACGGATAACAGCATAATTTGAATTAGTTTGTGACCTCGATGTTGGACTATGATCTTTAATACCTATAAGGAACTAAAATAATCTCTGTTCCAGCATTTATTCCTACTTGAACTGAATTCA

ü

ü

ä

FFFFFF

äüüü

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.

p

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Clausilia dubia

10.10.2019

Gitterstreifige Schließmundschnecke

In den Blättern des württembergischen Schwarzwald-Vereins von 1906, gibt es die einzige Beschreibung der Weichtiere des Schwarzwaldes der letzten Jahrhunderte. Zumindest die einzige, die ich bisher finden konnte.

Gleich am Anfang erwähnt der Autor

“In der Ruine “Kirneck” suchte ich einmal Zuflucht während eines Gewitters. Kaum waren die Mauern besprengt, so kroch Clausilia dubia zu hunderten aus den Ritzen hervor, Futter zu suchen; die Sandsteinfelsen in der Nähe aber waren gänzlich leer. “

Was liegt näher als bei Regen die Ruine Kirneck aufzusuchen und zu schauen was 113 Jahre später noch da ist?

Ruine Kirneck
Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Literaturrecherche Mobilfunk

19.08.2019

Da doch einige Behauptungen und Annahmen durch die Presse rauschen von wegen schädlich oder nicht schädlich vom Mobilfunk, habe ich mich dem Thema über die wissenschaftliche Literatur genähert. Hierfür habe ich die Veröffentlichungen von Januar-August 2019 herausgesucht und gelesen. Dabei habe ich sieben wissenschaftliche Veröffentlichungen gefunden die relevant wären und die ich hier kurz besprechen möchte.

Die erste Studie hat mich selber überrascht, es ist eine Studie aus Schweden bei der bei über 24.000 Menschen Kopfschmerzen, Tinnitus und Schwerhörigkeit in Bezug auf die Nutzung von Mobiltelefonen untersucht wurde (1).

Resultat der schwedischen Studie: Personen, die am häufigsten Mobiltelefone verwendeten, berichteten etwas häufiger über wöchentliche Kopfschmerzen als andere Benutzer. Dieser Befund verschwand jedoch nach Anpassung der Störfaktoren weitgehend und hing nicht mit der Anrufdauer bei GSM mit höheren HF-Frequenzen zusammen. Tinnitus und Hörverlust waren nicht mit der Anrufdauer verbunden.

In der zweiten Studie wurden die kognitive Fähigkeiten bei Kinder mit Handy untersucht (2).

Die Autoren sagen, dass frühere epidemiologische Studien zu gesundheitlichen Auswirkungen der Strahlenexposition von Mobiltelefonen zu inkonsistenten Ergebnissen geführt hätten.

Es wurden 619 Schüler zu Studienbeginn rekrutiert und Längsschnittdaten für 412 Schüler aus einer repräsentativen Stichprobe von 36 staatlichen, privaten und katholischen Schulen erhoben.

Es gab kaum Anhaltspunkte für einen signifikanten Zusammenhang zwischen der Nutzung von Mobiltelefonen und der kognitiven Leistung von Schülern (2).

Eine dritte Studie bietet einen ganz guten Überblick über die elektromagnetische Felder in verschiedenen Umgebungen und erläutert diese (3).

Bei einer vierten Studie wird es wieder spannender, weil es geht um Tumore des Gehirns und der Speicheldrüse und Verwendung von Mobiltelefonen (4). Hier handelt es sich um eine sogenannte “Meta-Studie”. Die Veröffentlichung kombiniert eine Vielzahl von Studien in einer Zusammenschau. Hier die Ergebnisse der Studie:

Zusammenfassend lässt sich sagen, dass die aktuellen Erkenntnisse aus allen verfügbaren Studien, einschließlich in-vitro-, in-vivo– und epidemiologischen Studien, keinen Zusammenhang zwischen dem Mobiltelefon Konsum und Tumoren erkennen lassen, die sich aus den am stärksten exponierten Organen und Geweben entwickeln. Angesichts des großen Forschungsaufwands zu diesem Thema ist davon auszugehen, dass potenziell nicht erkannte Risiken aus individueller Sicht gering sind und lange Latenzzeiten (> 15 Jahre), seltene Gehirntumorsubtypen und Mobiltelefon-Konsum im Kindesalter betreffen können. Um diesen geringen Risiken zu begegnen, ist eine qualitativ hochwertige Forschung mit genauer Expositionsabschätzung erforderlich, wobei zu berücksichtigen ist, dass die Dauer des MP-Anrufs allein die HF-EMF-Exposition des Gehirns nicht angemessen widerspiegeln wird.

Bei der 5. Studie geht es auch wieder um Krebs, insbesondere um diverse Hirntumore (5).

In einer populationsbasierten ökologischen Studie wurden die Trends von Hirntumoren in den Zeiträumen 1982–1992, 1993–2002 und 2003–2013 untersucht. Die Schlussfolgerungen der australischen Wissenschaftler ergaben keine Zunahme von Gehirntumor-Histologietypen oder Gliomlokalisationen, die auf Mobiltelefone zurückgeführt werden können.

Dann in der 6. Studie ergaben sich dann doch Auswirkungen von Mobilfunkmasten neben Schulen auf die Konzentrationsfähigkeit von Schulkindern (6). Allerdings gibt der Autor – ein Professor Sultan Ayoub Meo von der King Saud Universität in Riad – zu, dass seine Statistik mangelhaft sei. Er belegt seine Aussagen dann aber mit einigen hochkarätigen Veröffentlichung unter anderem einer vom Max-Planck-Institut für neurologische Forschung (7).

Bei dieser 13-seitigen Veröffentlichung scheint es sich um sowas wie ein Standardwerk zu handeln. Es wird sowohl die Blut-Hirn Schranke genau behandelt wie auch alle anderen physiologischen und neurologischen Zusammenhänge. Ich will hier nur kurz die Schlussfolgerungen des Max-Planck-Institut für neurologische Forschung aus (7) zusammenfassen:

Gegenwärtig gibt es kaum Hinweise darauf, dass eine gepulste oder kontinuierliche Mikrowellenexposition bei Leistung und Frequenzen im Zusammenhang mit der Mobilkommunikation die Funktionsfähigkeit und strukturelle Integrität des Gehirns beeinträchtigen könnte. Unter experimentellen Bedingungen konnten die meisten der bisher gemeldeten positiven Ergebnisse auf thermische Effekte zurückgeführt werden. Es ist unwahrscheinlich, dass solche Effekte bei regelmäßiger Verwendung von Mobiltelefonen auftreten, da die emittierte Gesamtleistung viel zu niedrig ist, um die Körpertemperatur zu erhöhen, und weil lokale Erhöhungen der Gehirntemperatur, falls vorhanden, durch die thermostabilisierende Wirkung des zirkulierenden Blutes verhindert würden.

Andere biologische Störungen, die unter Versuchsbedingungen beobachtet werden, können mit verfahrensbedingten Nebenwirkungen wie Immobilisierungsstress zusammenhängen, unter denen nicht betäubte Tiere leiden. Versuchsanordnungen sollten daher so konzipiert werden, dass die tatsächlichen Expositionsbedingungen für menschliche Benutzer von Mobilkommunikationssystemen nachgebildet werden.

Ebenso sind Wechselwirkungen mit menschlichem Verhalten oder neurologischen Erkrankungen bestenfalls minimal. Insbesondere konnte kein signifikanter Zusammenhang mit der Inzidenz oder dem Wachstum von Hirntumoren unter experimentellen oder klinischen Bedingungen hergestellt werden. Negative Daten schließen die Möglichkeit geringfügiger mikrowelleninduzierter biologischer Wirkungen auf das Gehirn nicht aus. Je geringer diese Nebenwirkungen sind, desto geringer ist ihr Beitrag zum kombinierten Gesundheitsrisiko, das andere Umwelteinflüsse auf das Gehirn ausüben können. Diese Schlussfolgerung steht möglicherweise im Widerspruch zu den offensichtlichen, aber wenig untersuchten Stressreaktionen, die viele Personen erfahren, wenn sie sich über rücksichtslose Benutzer von Mobiltelefonen ärgern. Beträchtliche Gesundheitsrisiken ergeben sich auch aus der hohen Anzahl von Verkehrsunfällen, die durch Mobiltelefonie während der Fahrt verursacht werden. Weitere Forschungen sollten sich daher auf diese indirekten Auswirkungen der Mobiltelefonie konzentrieren, die sich letztendlich als schwerwiegendere Belastung für die Gesundheitssysteme herausstellen können als die vermutlich vernachlässigbaren biologischen Störungen.

Professor Sultan Ayoub Meo will seine Studie mit einer weiteren wichtigen amerikanischen Veröffentlichung belegen. In dieser Studie wurde schon 2004 gezeigt, dass die aktuellen Beweise für einen ursächlichen Zusammenhang zwischen Krebs und Exposition gegenüber Hochfrequenzenergie schwach und nicht überzeugend sind (8).

Fazit aus der Recherche von Januar-August 2019

Die einzige wissenschaftliche Veröffentlichung von 2019 die den Mobilfunk kritisch sieht, hat nicht nur keinerlei Beweise für die Behauptung, sondern in den zitierten Journals steht auch das Gegenteil der Behauptung.

Umweltauswirkungen

Die siebente Veröffentlichung dieses Jahr, die ich zu diesem Thema gefunden habe, war ein hoch interessanter Übersichtsartikel über verschiedene Strahlungen und deren Auswirkungen auf Insekten (9).

Jedem Interessierten rate ich, diesen Artikel mal anzuschauen. Es wird einsichtlich in Diagrammen erklärt, was es überhaupt für Strahlung gibt und wie sich sich auswirken.

Was bei dem Artikel deutlich raus kommt:

Die Lichtverschmutzung ist unser größtes Problem!

Zusammenfassung

Es gibt entgegen vielen Behauptungen einen wissenschaftlichen Konsens in Sachen Mobilfunk. Von daher hat die Neue Zürcher Zeitung (NZZ) natürlich Recht. Ich empfehle dringen allen, die sich erst mal einen Überblick auf Deutsch verschaffen wollen die Lektüre des hervorragend Artikels von Andreas Hirstein am 27.04.2019 in der NZZ


(1) Headache, tinnitus and hearing loss in the international Cohort Study of Mobile Phone Use and Health (COSMOS) in Sweden and Finland (July 2019); International Journal of Epidemiology; Anssi Auvinen et al.; https://doi.org/10.1093/ije/dyz127

(2) Uncertainty Analysis of Mobile Phone Use and Its Effect on Cognitive Function: The Application of Monte Carlo Simulation in a Cohort of Australian Primary School Children (July 2019);
Int. J. Environ. Res. Public Health 2019, 16(13), 2428; https://doi.org/10.3390/ijerph16132428

(3) Radio Frequency Electromagnetic Fields Exposure Assessment in Indoor Environments: A Review (März 2019)
Int. J. Environ. Res. Public Health 2019, 16(6), 955; https://doi.org/10.3390/ijerph16060955

(4) Brain and Salivary Gland Tumors and Mobile Phone Use: Evaluating the Evidence from Various Epidemiological Study Designs. (April 2019); Annual Review of Public Health Volume 40, 2019 Röösli, pp 221-238;
https://www.annualreviews.org/doi/full/10.1146/annurev-publhealth-040218-044037

(5) Mobile phone use and incidence of brain tumour histological types, grading or anatomical location: a population-based ecological study. (Dezember 2018); Public health; Ken Karipidis et al;
https://bmjopen.bmj.com/content/8/12/e024489.long

(6) Mobile Phone Base Station Tower Settings Adjacent to School Buildings: Impact on Students’ Cognitive Health (Januar 2019); American Journal of Men’s Health; Sultan Ayoub Meo et al;
https://journals.sagepub.com/doi/full/10.1177/1557988318816914

(7) Effects of Electromagnetic Radiation of Mobile Phones on the Central Nervous System (2003); Bioelectromagnetics 24:49 ^ 62
https://onlinelibrary.wiley.com/doi/abs/10.1002/bem.10068

(8) Mobile phones, mobile phone base stations and cancer: a review (2005); International Journal of Radiation Biology https://www.tandfonline.com/doi/abs/10.1080/09553000500091097

(9) Risk to pollinators from anthropogenic electro-magnetic radiation (EMR): Evidence and knowledge gaps; Science of The Total; Volume 695, 10 December 2019; Environmenthttps://doi.org/10.1016/j.scitotenv.2019.133833


Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.