Category Archives: Hunde

Irreguläre Tierversuche in Erlangen

März 2018 aktualisiert am 14. April 2019

Die Friedrich-Alexander-Universität Erlangen-Nürnberg publizierte in den letzten Jahren eine Reihe nicht schlüssiger Veröffentlichungen, auf die ich hier näher eingehen will.

Tierversuche müssen nach §8 Tierschutzgesetz von der zuständigen Behörde (hier Regierung von Unterfranken) genehmigt werden. Die Behörde vergibt dazu eine Nummer. Mir ist aufgefallen, dass unter ein und derselben Genehmigungsnummer mehrere Tierversuche an verschiedenen Tierarten (Beagle und Schweine) publiziert wurden und dass für ein und denselben Versuch unterschiedliche Genehmigungsbehörden (Franken und Ungarn) angegeben werden.

In folgender Liste sind die widersprüchlichen Angaben aus den einzelnen Veröffentlichungen zusammengefasst:

Genehmigungsnummer
Jahr
Titel
DOI Genehmigungsbehörde   Autoren   verbrauchte Tiere
54-2532.1-45/12

2017

The influence of different abutment materials on tissue regeneration after surgical treatment of peri-implantitis – a randomized controlled preclinical study.

10.1016/j.jcms.2017.05.025

„Pest county government department for food safety and animal health“


Ungarn

 Tobias Moest, Jan Wrede, Christian Martin Schmitt, Melanie Stamp, Friedrich Wilhelm Neukam, Karl Andreas Schlegel   8 Beagle
54-2532.1-45/12

2016

Soft tissue volume alterations after connective tissue grafting at teeth: the subepithelial autologous connective tissue graft versus a porcine collagen matrix – a pre-clinical volumetric analysis

10.1111/jcpe.12547

„Pest county government department for food safety and animal health“


Ungarn

Christian Martin Schmitt, Regai E. Matta, Tobias Moest, Julia Humann, Lisa Gammel, Friedrich Wilhelm Neukam, Karl Andreas Schlegel   8 Beagle
54-2532.1-45/12

2014

Bone formation in peri-implant defects grafted with microparticles: a pilot animal experimental study.

10.1111/jcpe.12295

„a state Animal Research Committee in Bavaria“

Ansbach

Tobias Moest, Franz Koehler, Christopher Prechtl, Christian Martin Schmitt, Georg Watzek, Karl Andreas Schlegel   6 Schweine
22.1/121/3/2011

2017

Periosteal elevation induces supracortical peri-implant bone formation.

10.1111/jcpe.12547

„Pest county government department for food safety and animal health“


Ungarn

Rainer Lutz, Christina Sendlbeck, Hommeira Wahabzada, Christian Tudor, Christopher Prechtl, Karl Andreas Schlegel   24 Schweine
22.1/121/3/2011

2015

In vivo evaluation of biofunctionalized implant surfaces with a synthetic peptide (P-15) and its impact on osseointegration. A preclinical animal study.

10.1111/clr.12723

„Pest county government department for food safety and animal health“


Ungarn

Christian M. Schmitt, Markus Koepple, Tobias Moest, Konrad Neumann, Tamara Weisel, Karl Andreas Schlegel    10 Beagle
22.1/121/3/2011

2016

Search for a reliable model for bisphosphonate-related osteonecrosis of the jaw: establishment of a model in pigs and description of its histomorphometric characteristics.

10.1016/j.bjoms.2016.05.025

„under license“


keine Angabe

Konstantinos T. Mitsimponas, Tobias Moest, Christos Iliopoulos, Thomas Rueger, Cornelia Katharina Mueller, Rainer Lutz, K. Shakib, Friedrich Wilhelm Neukam, Karl Andreas Schlegel    12 Schweine
22.1/121/3/2011

2015

Establishment of a new pull-out strength testing method to quantify early osseointegrationdAn experimental pilot study.

10.1016/j.jcms.2015.10.005

„the Animal Research Committee“


keine Angabe

J. Nonhoff, Tobias Moest, Christian Martin Schmitt, T. Weisel, S. Bauer, Karl Andreas Schlegel    6 Schweine
54-2531-25/07

2011

Tierexperimentelle Studie zur Knocheneinheilung chemisch oberflächenmodifizierter Implantate im Typ- 2 diabetischen Schwein

Dissertation

„Tierversuchskommission der Regierung von Mittelfranken“


Ansbach

Tobias Moest   15 Schweine
54-2531-25/07

2016

Peri-implant defect regeneration in the diabetic pig:
A preclinical study

10.1016/j.jcms.2016.04.002

„Committee for Animal Research, Franconia“


Franken

Cornelius von Wilmowsky, Karl Andreas Schlegel, Christoph Baran, Emeka Nkenke, Friedrich Wilhelm Neukam, Tobias Moest   6 Schweine
54-2531-25/07

2011

Diabetes mellitus negatively affects peri-implant bone formation in the diabetic domestic pig.

10.1111/j.1600-051X.2011.01746.x

„Committee for Animal Research, Government
of Midfranconia“


Ansbach

Cornelius von Wilmowsky, Philipp Stockmann, Igor Harsch, Kerstin Amann, Philipp Metzler, Rainer Lutz, Tobias Moest, Friedrich Wilhelm Neukam, Karl Andreas Schlegel   25 Schweine
54-2531.31-25/07

2011

PEG matrix enables cell-mediated local BMP-2 gene delivery and increased bone formation in a porcine critical size defect model of craniofacial bone regeneration

10.1111/j.1600-0501.2011.02223.x

„Committee for animal research of the government of Middle Franconia“


Ansbach

Falk Wehrhan, Kerstin Amann, Aart Molenberg, Rainer Lutz, Friedrich Wilhelm Neukam, Karl Andreas Schlegel   15 Schweine
54-2531.31-25/07

2012

Critical size defect regeneration using PEG-mediated BMP-2 gene delivery and the use of cell occlusive barrier membranes – the osteopromotive principle revisited.

10.1111/j.1600-0501.2012.02489.x

„Committee for animal research of the government of Middle Franconia“


Ansbach

Falk Wehrhan, Kerstin Amann, Aart Molenberg, Rainer Lutz, Friedrich Wilhelm Neukam, Karl A. Schlegel   20 Schweine
621.2531.31-06/02

2011

Comparative analysis of osseointegration of titanium implants with acid-etched surfaces and different biomolecular coatings

10.1016/j.tripleo.2011.01.004

„government of Midfrankonia“


Ansbach

Cornelia Katharina Mueller, Michael Thorwarth, Michelle Schmidt, Karl Andreas Schlegel, Stefan Schultze-Mosgau   9 Schweine
621.2531.31-10/98

2009

Influence of residual alveolar bone height on osseointegration of implants in the maxilla: a pilot study

10.1111/j.1600-0501.2008.01598.x

„Regional
Government of Mittelfranken“


Ansbach

Matthias Fenner, Eleftherios Vairaktaris, Kathrin Fischer, Karl Andreas Schlegel, Friedrich Wilhelm Neukam, Emeka Nkenke   8 Schweine
22.1/3879/003/2008

2015

Extra-oral defect augmentation using autologous, bovine and equine bone blocks: A preclinical histomorphometrical comparative study.

10.1016/j.jcms.2015.02.012

„a state Animal
Research Committee „


keine Angabe

Tobias Moest, Falk Wehrhan, Rainer Lutz, Christian Martin Schmitt, Friedrich Wilhelm Neukam, Karl Andres Schlegel   20 Schweine

Was sagt uns nun diese lange Liste, ausser dass sie für mich sehr viel Arbeit war?

Unter der Genehmigungsnummer 54-2532.1-45/12 finden wir verschiedene Experimente bei denen zum einem Teil Schweinen Implantate in den Kopf geschraubt werden und bei anderen Experimenten bei Hunden Implantate im Kiefer getestet werden. Bei den getöteten Hunden steht, dass diese Genehmigungsnummer von einem „Pest county government department for food safety and animal health“ in Ungarn vergeben wurde. Weiter unten bei der Studie von 2017 steht jedoch, dass die Studie an der Friedrich-Alexander Universität, Erlangen-Nürnberg durchgeführt wurde. Also vergibt Ungarn Genehmigungsnummern für Experimente an Hunden in Erlangen? Vergibt Ungarn hierfür die selbe Nummern wie Ansbach für Experimente mit Schweinen?

Des weiteren gibt es unter der Nummer 22.1/121/3/2011 verschiedene Studien mit insgesamt 42 Schweinen und 10 Beagle, die alle an der Universität Erlangen durchgeführt wurden. Oder doch nicht? Zum Teil wird das Amt in Ungarn erwähnt, zum Teil nur ein „comittee“ oder „license“, einmal als Lieferant der Schweine (2015) die Renner GmbH, die, soweit ich informiert bin, nur in Deutschland Tiere liefert. Also doch Erlangen?

Da in den Veröffentlichungen um Professor Schlegel keine Kooperation mit Ungarn oder anderen Universitäten auszumachen ist, gehe ich davon aus, dass alle Versuche an der Universität Erlangen durchgeführt wurden. Dies wird auch zum Teil extra erwähnt. Soviel ich in Erfahrung bringen konnte, ist es nach dem ungarischen Tierschutzgesetz von 2013 verboten, Beagle in 6 Quadratmeter Käfigen in Einzelhaltung zu halten. Dies wird aber in jeder einzelnen Veröffentlichung extra erwähnt. Also werden die Hunde in den Buchten für die Schweine gehalten?

Fragen über Fragen. Wer kann diese wohl besser beantworten, als die Universität oder das zuständige Amt der Regierung von Unterfranken? Ich habe letztes Jahr viel Zeit damit verbracht die zuständigen Stellen zu einer Antwort zu bewegen und hier will ich die Bemühungen auflisten.

Kontaktversuch mit dem SG Tierschutzangelegenheiten der FAU

Zuständig für Tierschutzangelegenheiten der Friedrich-Alexander-Universität Erlangen-Nürnberg sind Mareen Ziegelmann und Dr. med. vet. Roland Jurgons. Auf meine Anfrage wurde tatsächlich am 21.08.2017 geantwortet. Auch wenn in der Antwort keine Informationen standen und sich natürlich nie wieder jemand gemeldet hat, so weiß ich es doch zu schätzen.

Kontaktversuch mit der Regierung Unterfranken

Zuerst habe ich das zuständige Veterinärwesen in Würzburg per E-Mail und mit einem Brief angeschrieben. Nach mehrmaligem Nachfragen erhielt ich diese E-Mail

Man benötigt also eine Anspruchsberechtigung, um zu erfahren, wie an einer Universität Tiere für Geld und Ruhm totgequält werden.  Ja, berechtigt bin ich scheinbar nicht und dass ich mit den Genehmigungsnummern nicht vor habe Handel zu treiben, kann ich nur schwer nachweisen. Die Nummern scheinen so geheim zu sein, dass sogar die Universität diese frei erfinden muss.

Da man mich über die falschen Nummern leider nicht aufklären wollte, habe ich die Regierung Unterfanken gebeten in dieser Sache zu ermitteln und mich über das Ergebnis in Kenntnis zu setzen

Hierauf bekam ich erst Monate später eine Antwort, nachdem ich das Bayerische Staatsministerium angeschrieben hatte.

Kontaktversuch mit dem Bayerischen Staatsministerium Umwelt und Verbraucherschutz

Mein Brief an die Ministerialrätin Frau Dr. Marscher wurde sehr freundlich beantwortet.

Worauf hin sich auch die Regierung Unterfranken noch ein letztes Mal gemeldet hat.

Kontaktversuch mit ungarischen Universitäten

Des Weiteren habe ich versucht heraus zu finden, mit welcher ungarischen Universität ein Kontakt bestehen könnte und die fünf in Frage kommenden Universitäten angeschrieben. Als einzige Universität hat das Dekanat der Universität Budapest geantwortet.

Kontaktversuch mit den Verlagen

Beim Publizieren gibt es ethische Standards für Tierversuche. Diese werden als sogenannte „ARRIVE Guidelines“ für eine Publikation gefordert. Unter anderem werden relevante Lizenzen und eine ethische Überprüfungserlaubnis gefordert. Da die Nummern der Lizenzen in den Publikationen nicht stimmen können, habe ich die relevanten Verlage darauf aufmerksam gemacht, dass ihre ARRIVE Guidelines trotz gegenteiliger Behauptung nicht eingehalten wurden.

Diese E-Mails gingen an das Journal of Cranio-Maxillofacial Surgery vom Elsevier Verlag und an das Journal of Clinical Periodontology Surgery vom Wiley Verlag.

Da Professor Dr. Friedrich W. Neukam Editor des Journal of Cranio-Maxillofacial Surgery ist, habe ich hier auch keine Antwort erwartet. Allerdings kam vom Wiley Verlag eine positive Antwort:

Kontaktversuch mit Budapest

Die Gruppe um Professor Schlegel erwähnt als einzige das „Pest county government department for food safety and animal health“ in Ungarn erwähnt, folglich muss es da wohl einen Zusammenhang geben. Professor Schlegel hat 1998 in Budapest promoviert. Damals waren in Ungarn noch „wilde“ Tierversuche möglich und einige deutsche Institute verlagerten Tierversuche deshalb nach Ungarn. Inzwischen hat sich durch das ungarische Tierschutzgesetz von 2013 und auch durch die EU vieles geändert.

Unter dem Namen „Pest county government department for food safety and animal health“ gibt es ein Amt der Regierung namens Nébih. 

Da E-Mails an die Direktoren leider keine Resonanz zeigten, habe ich einen Brief geschrieben. Es hat mich eben auch wegen der offensichtlichen Kontakte von Professor Schlegel mit diesem Amt doch erstaunt, dass ich im Februar 2018 eine kurze Antwort erhalten habe:

Die Genehmigungsnummer 54-2532.1-45/12 gibt es also dort nicht. Was auch irgendwie zu erwarten war. Der Vollständigkeit halber will ich hier noch meine Antwort und erneute Anfrage an die nébih einfügen:

Obwohl ich Ideen habe, wen ich noch anschreiben könnte, überlasse ich an diesem Punkt nach 8 Monaten Hinterfragen und Lästigsein, die Arbeitsgruppe um Professor Schlegel meinem Lieblingsverein und der Staatsanwaltschaft.

Reaktionen

Anscheinend ist von meiner Welle einiges bei den Herren angekommen. Ich vermute mal die vom Wiley Verlag. Bei ihrer neuesten Veröffentlichung, vom Dezember 2017, haben sie versehentlich wieder die gleichen Fehler gemacht.

Da ist wohl zum wiederholen Mal die falsche Nummer 54-2532.1-45/12 rein gerutscht. Jetzt da bewiesen ist, dass diese nicht stimmt, wird schnell eine neue Nummer herbei gezaubert.

Daneben wird bedauert, dass man die Tiere vor ihrem Tod nicht gemäß des Tierschutzgesetzes gehalten hat. Das war wohl nur ein Fehler im Satz. In Zukunft werden sie ihre Worte wohl besser planen, als ihre Taten.

Strafanzeige

Am 10. April 2019 hat der Verein Ärzte gegen Tierversuche e.V. Strafanzeige gegen Forscher der Friedrich-Alexander-Universität Erlangen-Nürnberg (FAU) wegen Verdachts auf Verstoß gegen das Tierschutzgesetz gestellt.

Der genaue Text der Pressemitteilung kann hier nachgelesen werden:

Ein sehr guter Artikel dazu gab es im Ärzteblatt am 11. April 2019

Es ist der totale Wahnsinn. Jetzt wären alle Studien nicht in Erlangen durchgeführt worden.

Aus der idowa von Gunnar Giftthaler am 13.04.2019:

Laut Unterlagen des Sachgebiets Tierschutzangelegenheiten der FAU habe es seit 2001 weder Versuche an Beagle-Hunden noch an Schweinen gegeben, so Pressesprecherin Dr. Susanne Langer. Es handele sich offensichtlich um an ungarischen Partnerinstitutionen durchgeführte und dort genehmigte Versuche. Dass die FAU damit in Zusammenhang gebracht werde, sei eine „möglicherweise fehlerhafte Angabe in den Publikationen.“

Was sagt die zuständige Regierung von Unterfranken zu dem Thema? „Wir sind insbesondere bei dem heiklen Thema der Tierversuche äußerst transparent“, so Pressesprecher Johannes Hardenecke gegenüber idowa. Zwischen 2007 und 2012 habe es nachweisbar keine Tierversuche gegeben, der Zeitraum zwischen 2013 und 2018 werde derzeit überprüft. 

Da hängen sicher einige Dr. Arbeiten mit drin. Das meiste hab ich ja gar nicht übersetzt, weil das mit den Schweinen und Erlangen hatte ich geglaubt. Seit 2001 keine Tierversuche mit Schweinen in Erlangen?

Jetzt bin ich erst mal sprachlos. Es ist mir noch nicht ganz klar, sind die so doof oder warum sind die so selbstsicher?

…so Pressesprecher Johannes Hardenecke gegenüber idowa. Zwischen 2007 und 2012 habe es nachweisbar keine Tierversuche gegeben, der Zeitraum zwischen 2013 und 2018 werde derzeit überprüft. 

Aus der Dissertation:

„Nach Genehmigung des Tierversuches durch die zuständige Tierversuchskommision der Regierung von Mittelfranken, Ansbach (Genehmigungsnr. 54-2531-25/07) wurden 15 Tiere in die Studie eingeschlossen, die hier auf 4 Versuchsgruppen aufgeteilt wurden. Es gab 2 Opferungszeitpunkte in der jeweils diabetische und gesunde Schweine geopfert wurden. Am ersten Opferungstermin (nach 30 Tagen Einheilung) wurden 7 Tiere (2 mit gesunder und 5 mit diabetischer Stoffwechsellage) geopfert. Nach 90 Tagen post implantationem wurden die übrigen Tiere (2 mit gesunder und 6 mit diabetischer Stoffwechsellage) geopfert.

von Tobias Möst, Erlangen, Januar 2011

….es seit 2001 weder Versuche an Beagle-Hunden noch an Schweinen gegeben, so Pressesprecherin Dr. Susanne Langer…

Im September 2019 stellt die Staatsanwaltschaft die Ermittlungen ein, da alle Versuche vor 2014 verjährt seien und bei allen Veröffentlichungen nach 2014 der Autor eingeräumt hätte, dass „Ungereimtheiten in Bezug auf Genehmigungsnummern, Genehmigungsbehörden und Ort der Tierversuche auf fehlerhafte Zitierungen zurückzuführen sind“

.

.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Impfungen

Februar 2015

Impfungen für den Hund

Das Impfen ist ein stark diskutiertes Thema und oft prallen leidenschaftliche Behauptungen von Impfkritikern auf eine finanzstarke Lobby der Pharmaindustrie. Wir wollen hier auf die wichtigsten Argumente in dieser Diskussion eingehen und diese auch etwas erläutern.

Wenn Sie mit Ihrem Hund ins Ausland reisen wollen, benötigt Ihr Tier die jeweils vorgeschriebenen Impfungen und einen gültigen EU Heimtierausweis. Jedes Land und jede Veranstaltung hat etwas andere Anforderungen. Wenn Sie verreisen wollen, finden Sie auf der Seite Pets on Tour sehr viele gute Ratschläge. Was zum Beispiel allen Vorschriften in allen Ländern gemeinsam ist, ist eine gültige Tollwutimpfung und die Kennzeichnung Ihres Hundes per Mikrochip. Beides muss im blauen EU-Heimtierausweis dokumentiert sein. Einige Länder fordern eine jährliche Auffrischung, andere nur alle 5 Jahre. Deshalb ist es ratsam sich vorher eingehend zu informieren um vor bösen Überraschungen sicher zu sein. Wenn bei einem Hund ein Tollwutverdacht vorliegt und er nach den jeweiligen Bestimmungen keine gültige Tollwutimpfung hat, kann eine sofortige Tötung angeordnet werden. Eine Behandlung von erkrankten und verdächtigen Tieren ist gesetzlich verboten.

Bevor wir näher auf das komplexe Imfpgeschehen eingehen, kommt hier erstmal eine Übersicht der gängigen Impfungen die zur Verbeugung durchgeführt werden können. Man unterscheidet zwischen inaktiven und Lebendimpfstoffen. Lebendimpfstoffe enthalten den abgeschwächten Erreger, welcher zwar eine Immunantwort auslösen aber nicht zur Erkrankung führen kann. Inaktive Impfstoffe enthalten den getöteten Erreger oder Bestandteile von Viren oder Bakterien, welche dann die Immunantwort auslösen. Hunde werden in der Regel gegen folgende Krankheiten geimpft (alphabetische Reihenfolge):

datei-04-10-16-14-01-01

Borreliose – Infos über Borreliose 
Lyme-Borreliose Komplex (B), 8. + 12. Woche, optionale Auffrischung jährlich.
Komplex der Borrelia Bakterien umfasst weltweit 12 Spezies. Seit 2010 ist eine Impfung gegen die  Borrelien-Spezies B. afzelii und garinii erhältlich. Hier gibt es einen sehr guten Übersichtsartikel von Herrn Professor Friedrich, bei dem man die Schlussbemerkung beachten sollte.

Hepatitis  – Infos über Hepatitis beim Hund 
Canines Adenovirus (Hcc), 8. + 12. + 16. Woche, optionale Auffrischung jährlich.
Sehr wirksame Immunprophylaxe mit einem nah verwandten Virus, dem caninen Adenovirus 2 (CAV-2).

Leptospirose  – Infos über Leptospirose leptospirose
Leptospirose (L), 8. + 12. Woche, jährliche Auffrischung.
Inaktivierte Impfstoffe mit Leptospira interrogans, Serotyp canicola und Leptospira interrogans Serotyp icterohaemorrhagiae. Impfstoff schützt nicht vor den Serotypen (L. pomona, L. Grippotyphosa), die zurzeit die meisten Infektionen verursachen (1). Es gibt allein in der Spezies Leptospira interrogans über 250 verschiedene Serotypen (2). Die Leptospirose ist auf den Menschen übertragbar und eine meldepflichtige Krankheit. Im Jahr 2011 sind, laut Robert-Koch Institut, 51 Menschen in Deutschland daran erkrankt. Nach der Grundimmunisierung muss eine jährliche Wiederholungsimpfung durchgeführt werden.

Parvovirose – Infos über Parvovirose
Provovirus (P), 8. + 12. + 16. Woche, optionale Auffrischung jährlich.
Es gibt inaktivierte Vakzine und Lebendimpfstoffe. Erfolg der Grundimmunisierung hängt vor allem vom richtigen Zeitpunkt der Impfung ab. Siehe weiter unten „immunologische Lücke“. Für eine Wiederholungsimpfung kann der Parvovirusantikörper-Titer im Blut zur Entscheidung über die Notwendigkeit herangezogen werden.

Staupe – Infos über Staupe
Distemper (S), 8. + 12. + 16. Woche, optionale Auffrischung jährlich.wpid-10055
Es gibt verschiedene Impfstoffe, aber nur die Lebendimpfstoffe haben sich als wirksam erwiesen. Der Erfolg der Impfung und Grundimmunisierung hängt wie bei der Parvovirose vom richtigen Zeitpunkt der Impfung ab. Siehe weiter unten „immunologische Lücke“. Für eine Wiederholungsimpfung kann der Antikörper-Titer im Blut zur Entscheidung über die Notwendigkeit herangezogen werden.

Tollwut – Infos über Tollwut 
Rabies (T), 12. + 16. Woche, optionale Auffrischung jährlich.
Gegen die Tollwutviren sind nur inaktivierte Impfstoffe in Verbindung mit einem Adjuvans zugelassen. Sowohl bei Erstimmunisierungen, als auch bei Wiederholungsimpfungen gilt der Impfschutz für den Zeitraum, den der Impfstoffhersteller für eine Wiederholungsimpfung angibt. Eine Tollwutimpfung sollte möglichst als Einzelimpfung vorgenommen werden. Eine Auffrischimpfung mit einem Einzelimpfstoff erzielt einen besser nachweisbaren Tollwutantikörper-Titer im Blut.

Zwingerhusten – Infos über Zwingerhusten
Zwingerhustenkomplex, canine infektiöse Tracheobronchitis (PI), 8. + 12. Woche, optionale Auffrischung jährlich.
Für die Prophylaxe stehen Lebendimpfstoffe zur Verfügung, die Einzelkomponenten (Bordetella bronchiseptica) und auch Kombinationen enthalten können. Da die Impfung nicht das gesamte Erregerspektrum des Zwingerhustenkomplexes abdeckt und das Krankheitsgeschehen zudem von weitere Faktoren beeinflusst wird, bewirkt die Impfung keinen vollständigen Schutz. Die Impfung ist nur für Welpen unter intensiven Aufzuchtbedingungen, in Tierheimen und Tierpensionen zu empfehlen.
Außerdem gibt es noch einen kombinierten Impfstoff (BbPi), welcher aktiv gegen Bordetella bronchiseptica und das Canine Parainfluenza-Virus immunisiert. Dieser Impfstoff wird über die Nasenschleimhäute des Hundes verabreicht und ist zur Vorsorge bei kurzzeitig erhöhter Infektionsgefahr wie zum Beispiel vorübergehendem Aufenthalt in einem Zwinger oder einer Tierpension empfohlen.

Wer sich genauer informieren will, kann sich die Leitlinie zur Impfung von Kleintieren der ständigen Impfkommission im Bundesverband Praktizierender Tierärzte e.V. genauer anschauen:

Leitlinie zur Impfung von Kleintieren

leitlinie-2009

Hier geht’s zur Liste der zugelassenen Hundeimpfstoffe vom Paul-Ehrlich-Institut:  pe

Hundeimpfstoffe

wpid-10055Das Prinzip der Impfung anhand der Geschichte

Was eine Impfung ist, lässt sich anhand der Geschichte und am Beispiel der Pocken am einfachsten erklären.

Die Pocken, oder auch Blattern, waren eine gefährliche Viruskrankheit, die über Jahrtausende nicht zu heilen war, wirkungsvolle Vorbeugungsmaßnahmen gab es auch nicht, und an der etwa 30% aller infizierten Menschen starben. Im Jahre 1794 machte sich Edward Jenner ein uraltes Wissen zu Nutze, nach dem einmal von den Pocken genesene Menschen nie mehr an dieser Krankheit litten. Jenner benutzte zum Immunisieren die für den Menschen relativ ungefährlichen und nahe verwandten Kuhpocken.

Was beim Immunisieren passiert, ist im Grunde ein „scharfmachen“ vom körpereigenen Immunsystem. Man zeigt dem Immunsystem den Eindringling und der Organismus bildet Antikörper dagegen. In dem Beispiel hat Jenner dies anhand der relativ ungefährlichen Kuhpocken getan.

Hier zeigt sich auch schon die Problematik der Impfung: Man braucht etwas relativ ungefährliches, das man dem Immunsystem zeigen kann, aber das auch ähnlich genug mit dem gefährlichen Erreger ist, um diesen effektiv zu erkennen und unschädlich zu machen.

Dies lässt sich auch wieder gut anhand der Pocken zeigen. So ist eine Impfung mit dem Kuhpockenerreger zwar relativ ungefährlich, aber trotzdem sterben etwa zwei Menschen pro einer Million Geimpfter an den Kuhpocken. Dies erscheint wenig angesichts der Schwere der Erkrankung, aber für diese zwei Menschen und deren Familien ist dies natürlich unerheblich.

So stellt und stellte sich immer wieder die Frage der Gefahr einer Impfung im Kontext zur Gefahr einer Erkrankung. Hinzu kommt: Je höher der Prozentsatz der Geimpften ist, um so geringer ist das Risiko eines Einzelnen an der Krankheit zu erkranken.

Zusammenfassend kann man sagen, dass diejenigen, die das Risiko der Impfung auf sich nehmen, nicht nur gegen die Krankheit relativ gut geschützt sind, sondern auch diejenigen schützen, die das Risiko einer Impfung nicht auf sich nehmen wollen oder dazu keine Möglichkeit haben.

Das Impfrisiko und seine Bedeutung

Anhand der Kuhpocken und der Pocken kann man erkennen, dass die Frage des Risikos immer eine statistische Abwägung ist. Solange die Pocken überall verbreitet waren und alle Menschen direkt bedroht haben, war eine Impfung aller Menschen sicher wichtig. Seit die Pocken aber fast ausgerottet worden sind, konnte man in den 1970er Jahren die Impfpflicht aufheben, da das Impfrisiko bei weitem über der Gefahr einer Erkrankung lag.

Es wird zwischen LebendimfstoffenTotimpfstoffen und Adjuvanzien unterschieden. In der Immunologie werden Adjuvanzien eingesetzt, um die Immunantwort auf eine verabreichte Substanz zu steigern. Man braucht also beim Einsatz eines Adjuvans weniger vom Erreger oder sogar nur einzelne Zellwandproteine von diesem, um eine Immunantwort zu erreichen.

All diese verschiedenen Möglichkeiten haben ihre ganz spezifischen Risiken und Vorteile. Da man nicht in die Zukunft schauen kann, wie sich Krankheitserreger und deren Pathogenität entwickeln, kann jede einzelne Impfung nur eine Abwägung vom Risiko und Nutzen sein. Hilfreich bei dieser Abwägung ist erst einmal zu wissen, wie gefährlich eine Krankheit ist und ob man überhaupt impfen kann. Wenn man impfen kann, sollte man schauen, in welcher Form geimpft wird. Gegen welchen Erreger wird geimpft? Bei der Borreliose gibt es zum Beispiel 12 Spezies. Nützt es mir den Hund gegen nur eine Spezies davon zu impfen? Wem nützt es einen Hund gegen einen einzelnen Stamm aus dem Zwingerhustenkomplex zu impfen?

Des Weiteren sollte man auch beim Impfschutz die Möglichkeiten und Unterschiede von Grundimmunisierung, Auffrischimpfungen, die „Immunologische Lücke“ und die Antikörper-Titerbestimmung im Blut in betracht ziehen. Hierauf wollen wir im nächsten Kapitel eingehen.

husky

Die Grundimmunisierung, der Impfschutz und die „immunologische Lücke“

Wie schon oben erwähnt, sagt man bei einer Impfung dem Immunsystem was es bekämpfen soll. Das Immunsystem produziert daraufhin Antikörper und der Körper macht sich bereit, alles was genauso aussieht zu bekämpfen.

Der Welpe hat zum Zeitpunkt seiner Geburt bereits ein voll entwickeltes Immunsystem, aber die Antikörper sind noch von seiner Mutter. Nach der Geburt werden weitere Antikörper mit der Muttermilch aufgenommen. Diese maternellen Antikörper werden nach und nach abgebaut und diese Restmenge an mütterlichen Antikörpern kann die Impfung stören. Diese kritische Phase wird als „immunologisch Lücke“ bezeichnet. Deshalb steht auch auf den Beipackzetteln für Staupe-, Hepatitis-, Leptospirose- und Parvovirose-Impfstoffen: “Der Impfplan muss die beim Welpen vorhandenen, kolostral vermittelten maternalen Antikörper berücksichtigen”.

Der richtige Zeitpunkt zum Impfen ist also erst nachdem alle mütterlichen Antikörper abgebaut sind. Durch eine Antikörper-Titerbestimmung im Blut läßt sich der optimale Impfzeitpunkt und auch der Erfolg der Impfung nachweisen.

Wegen der unterschiedlichen Zusammensetzung der Impfstoffe sollten die Impfstoffe vom gleichen Hersteller sein. Die Dauer des Impfschutzes nach erfolgreicher Grundimmunisierung ist unterschiedlich. Bei Viruskrankheiten wie Staupe, Hepatitis und Parvovirose kann man von mindestens 7 Jahren ausgehen. Bei Tollwut sollte man, auch wegen gesetzlichen Vorgaben, unter vier Jahren bleiben. Wenn man sich nicht sicher ist, kann man den Antikörper-Titer bestimmen lassen.

Hier soll noch erwähnt werden, dass neben der „immunologischen Lücke“ auch Stress oder Krankheit den Impferfolg beeinträchtigen können.

cody

Gefahren der Impfung

Heute bestreitet niemand mehr, dass es Impfschäden gibt. Gerade die früher viel zu häufig durchgeführte Tollwutimpfung kann zu einigen gesundheitlichen Problemen führen. In Deutschland gibt es eigentlich nur vier wichtige Impfungen für den Hund. Dies sind

  • Staupe (S)
  • Hepatitis (Hcc)
  • Parvovirose (P)
  • Tollwut (T)

Je nach persönlichem Risiko, zum Beispiel wenn der Hund gern aus Pfützen trinkt, ist auch die Impfung gegen Leptospirose empfehlenswert. Fragen Sie hierzu Ihren Tierarzt.

Falls man nicht ins Ausland reisen will, könnte für Staupe, Hepatitis und Parvovirose eine erfolgreiche Grundimmunisierung ausreichen. Wobei man darauf achten sollte, ob die Grundimmunisierung (Bluttest) auch erfolgreich war.

Bei der Tollwutimpfung wird es etwas komplizierter, da man unbedingt die gesetzlichen Vorgaben erfüllen sollte. Die Vorgaben in Deutschland sind heute eine Grundimmunisierung und eine Auffrischung, die der Impfstoffhersteller für die jeweilige Wiederholungsimpfung angibt. Hier kann man sich einen Impfstoff aussuchen, der nur alle drei oder vier Jahre aufgefrischt werden muss. Gerade kleine Hunde oder Hunde mit Autoimmunkrankheiten können aber durch wiederholte Tollwutimpfungen Schaden erleiden. Wenn Sie sich wegen Vorerkrankungen oder aus anderen Gründen Sorgen um Ihren Hund machen, lassen Sie regelmäßig den Antikörper-Titer bestimmen. Dieser wird mit dem „Fluorescent Antibody Virus Neutralization (FAVN) Test“ bestimmt und sollte über 0,5 IU/ml liegen. Bitte beachten Sie, dass Sie aber auch hierfür eine erfolgreiche Grundimmunisierung benötigen. Die Titerbestimmung können Sie in Ihren Heimtierausweis legen und haben für den Fall der Fälle eine sehr gute Argumentationshilfe.

Lassen Sie sich nicht verrückt machen. Es gibt sicher Hunde, die an Impfungen gestorben sind. Es gibt aber sehr viel mehr Hunde, die an vermeidbaren Krankheiten verendet sind. Nun haben Sie das nötige Wissen selbst zu entscheiden.

Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

wpid-10055

1. Prevalence of the Leptospira serovars bratislava, grippotyphosa, mozdok and pomona in French dogs. Claire Renaud et. al., The Veterinary Journal 196 (2013).

2. Leptospirosis. Center for Food Security and Public Health. College of Veterinary Medicine Iowa State University. (2005)

 

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Körpersprache und Mimik bei Hunden

April 2015

Lange hat niemand verstanden warum Hunde bei einer Gruppe von Menschen immer wissen, wer am ehesten heimlich Essen unter den Tisch fallen lässt. Heute scheint es, dass die Antwort ganz einfach ist: Die Tiere sind in der Lage, die menschliche Mimik zu lesen.

Ein Team von der University of Florida hatte bemerkt, dass Hunde die viel Kontakt mit Menschen haben, sehr stark auf verbale und nicht verbale Signale reagieren (1). Es gibt eine einfache Erklärung – die Hunde haben gelernt Leute zu beobachten und ihre Gesten zu lesen. Dies ist auch der Grund warum Hunde sich zu benehmen wissen, wenn wir dabei sind, aber sobald wir wegschauen wird der Schelm ausgepackt.

Lange Zeit haben Wissenschaftler die Fähigkeit von Hunden, die Mimik des menschlichen Gesichts zu sehen und zu interpretieren, unterschätzt. Es wurde davon ausgegangen, dass Mimik in der Kommunikation von Wölfen und Hunden keine so große Rolle spielt, wie in der Kommunikation von Primaten. Dies kam daher, dass die Forscher die Mimik einfach nicht sehen konnten, da die Ausdrücke sich sehr schnell, innerhalb von Millisekunden, ändern. Mit dem Fortschritt der modernen Foto-und Videoausrüstung hat sich dies geändert.

Ein gerne zitiertes Beispiel ist eine Situation in der sich zwei fremde Hunde treffen und sich für eine Weile nur gegenüber stehen und nichts tun. Bis auf ihre Nasen sieht man nicht, dass die Hunde miteinander kommunizieren. Allerdings würde eine empfindliche Videokamera festhalten können, dass in diesen wenigen Sekunden Hunde mit Hilfe ihrer Gesichtsmuskeln eine Menge erzählen. Diese Informationen decken den sozialen Status, ihre Rechte auf das Gebiet, die Höflichkeit und Einvernehmlich ab.

ice-tippi

Da Hunde und auch Wölfe durch die Gesichtsmuskeln kommunizieren, versuchen Sie natürlich auch beim Menschen herauszufinden was wir sagen. Sie bemerken die kleinsten und subtilsten Bewegungen der mimischen Muskeln, auch die, die Menschen nicht in der Lage sind wahrzunehmen. Mehrere Experimente mit Hunden fanden, dass die Tiere Menschen buchstäblich auf einen Blick verstehen (2).

Es stellte sich heraus, dass Hunde den Menschen besser lesen können, als Menschen sich gegenseitig. Unsere Gesichtsmuskeln spiegeln unsere Absichten und Wünsche wieder, ob wir es wollen oder nicht. Kein Mensch kann die unzähligen Muskeln in seiner Mimik jede Sekunde kontrollieren.

cody

Aufgrund der Tatsache, dass Hunde ein gutes Gedächtnis haben und dass sie schnell lernen die „Sprache“ der menschlichen Mimik und unsere Stimmung bewusst zu lesen, ist es nicht verwunderlich, dass es für Hunde nicht schwer ist den Menschen zu entschlüsseln (4). Natürlich lässt sich dies auch von uns lernen und viele Hundetrainer und Hundeerfahrene sprechen von „Intuition“.

Die Verhaltensforschung von Hunden ist ein sehr großes Gebiet mit unzähligen neuen Erkenntnissen und Veröffentlichungen. Ich will hier nur etwas auf einige ausgewählte neue Erkenntnisse in der Kommunikation eingehen. Falls Sie sich für ein spezielles Thema interessieren, können Sie auch gerne im Forum von Petsnature nachhaken oder bei einem Buchhändler Ihrer Wahl in der Fachliteratur schmökern.

Das Gähnen und Schnauze lecken

Ansteckendes Gähnen ist ein gut dokumentiertes Phänomen und erhält seit einiger Zeit viel Aufmerksamkeit in der Verhaltensforschung. Ansteckendes Gähnen konnte bei 69% der 4-14 Monate alten Welpen und sogar bei über 72% der erwachsenen Hunden nachgewiesen werden (3).

Des Weiteren ist Gähnen, wie auch die eigene Schnauze lecken, seit einiger Zeit als sogenanntes Beschwichtigungssignal bekannt. Also Hunde gähnen, oder lecken vor ihrer Nase, um eine Bedrohung abzuwehren und sich selber auch zu beruhigen. Wenn sich eine Person oder ein anderes Tier nähert, kann der Hund seinen Blick abwenden, lecken und dann gähnen. Der Hund sagt damit, dass er sich bedroht fühlt und dass er selber aber nicht angreifen will. Hunde nutzen diese Art der Körpersprache, um Konflikte zu vermeiden.

Beobachten Sie Ihren Hund, es gibt sicher viele Situationen in denen er beschwichtigt. So wenden sich viele Hunde ab und gähnen oder lecken, wenn Kinder oder Erwachsene streiten, wenn ein Kind den Hund umarmt oder bei anderen spannungsgeladenen Situationen.

Niki

 

Das Bewusstsein dessen, was Ihrem Hund Angst verursacht, kann Ihnen helfen zu verhindern, ihn diesen Situationen auszusetzen. Gerade das Lecken, kann sehr schnell und fast nicht wahrnehmbar sein. Man muss sich darauf trainieren es zu sehen. Wenn Sie schnell genug ihren Hund aus der Situation bringen können, zeigen Sie ihm, dass Sie sich kümmern und er es nicht selber in die Hand nehmen muss. Das Wissen darüber ist auch nicht zu unterschätzen, um Beissvorfälle – vor allem das Schnappen nach Kindern – zu verhindern. Jeder Hund warnt vor, man muss es nur sehen.

Sie können auch auf die selbe Art mit Ihrem Hund sprechen. Kein Hund nimmt es Ihnen übel wenn Sie ihm die Zunge raus strecken. Auch lassen sich viele Hunde durch Gähnen beruhigen, vor allem, wenn Sie ein ansteckendes Gähnen hin bekommen.

Der Schwanz

Der Schwanz kann sehr viel sagen, deshalb ist er auch für Hunde so wichtig. Nicht nur die Haltung vom Schwanz, die Höhe, die Art des Wedelns und Wackelns, auch die Richtungen sind sehr wichtig.

Wenn der Schwanz hoch gehalten wird, zeigt es normalerweise, dass der Hund aufmerksam ist. Der Schwanz zwischen den Beinen bedeutet, dass der Hund Angst hat. Wenn sich das Fell am Schwanz sträubt, ist der Hund bereit, sich selbst oder andere zu verteidigen.

Ein kurzes, langsames wackeln mit dem Schwanz ist ein Fragen und Unsicherheit. Groß und schnell wackeln Hunde die glücklich und aufgeregt sind. Je nach Haltung, kann dies aber auch Aggression signalisieren.

Des weiteren haben Hunde eine „Links-Rechts-Asymmetrie“ bei der der Schwanz während der Interaktion mit Fremden zeigt was Sache ist. Wenn der Schwanz eher nach rechts beim Wedeln gelagert ist, ist dies mit positiven Gefühlen verbunden. Der Hund freut sich und findet den anderen nett (5).

rechts

Ein weißer Punkt an der Schwanzspitze vereinfacht die Kommunikation. Hunde hingegen die keinen Schwanz mehr haben, müssen ihren Popo zur Hilfe nehmen und sind oft in der Kommunikation etwas sprachbehindert.

Ohren

Die Ohren zeigen meist in Richtung der Aufmerksamkeit. Stehohren nach vorne bedeutet, der Hund ist sehr aufmerksam und das Abknicken vom Ohr bedeutet Unterwürfigkeit oder aber auch, wenn die Zähne dazu gezeigt werden, Aggression.

Hunde mit Hängeohren können diese Signale nicht verwenden, was aber nicht sonderlich schlimm ist, da die Ohren ja automatisch angelegt sind. Schwierig wird es dann bei Hunden mit kupierten Ohren, weil diese die Ohren nicht mehr anlegen können und es so zu Missverständnissen kommen kann.

Nun wird also auch das erste Foto hier im Artikel klar:

spielen

 

Maul und Zähne

Wenn ein Hund stark die Lippen zurück zieht, kann dies zeigen, dass der Hund beißen will. Dies ist ein unbewusster Reflex, um die Lefzen von den Zähnen zu nehmen, damit er besser beissen kann. Allerdings ist dies weniger Kommunikation und die aggressive Absicht wird oft auch falsch interpretiert. Zum Beispiel werden viele Hunde ihre Lefzen kräuseln, wenn sie einen Keks oder Knochen nehmen wollen. Sie wollen sich ja nicht selbst auf die Lefzen beissen dabei.

Eine Form der Zähne entblößen ist das „unterwürfige Grinsen“. Dies bedeutet, dass der Hund es freundlich meint. In diesem Fall wird der Hund auch anderes Verhalten zeigen, wie Schwanzwedeln und gesenkte Körperhaltung. Manche Hunde zeigen eine unterwürfiges Grinsen, wenn sie bei etwas erwischt werden, was sie nicht hätten tun dürfen. Andere einfach auch nur, wenn sie sich freuen.

Eine sehr häufige Form der Kommunikation ist auch einen anderen Hund oder einen Menschen zu lecken. Hunde lecken anderen Hunden die Gesichter und Münder, wenn sie einander freundlich begrüßen. Lecken ist eine soziale Bindung analog zur sozialen Fellpflege die Primaten verwenden.

Augen

Hunde drücken sehr viel mit den Augen aus. So wird das direkte Anstarren in die Augen als Aggression gedeutet. Hunde die gut mit Menschen sozialisiert sind, wissen dass der Mensch es nicht so meint, werden aber sofort zur Seite schauen und auch Beschwichtigungssignale zeigen.
Deshalb starren Sie bitte fremden Hunden nie direkt in die Augen. Wenn es ein fremder Hund bei Ihnen tut, dann wenden Sie sich ab und beschwichtigen Sie, am besten mit Gähnen. Das ist vor allem dann hilfreich, wenn sich zwischen Ihnen und dem Hund kein Zaun befindet.

husky

Wenn sie Ihren Hund zu sich rufen und ihm dabei aufrecht in die Augen starren, wir er ganz bestimmt nicht zu Ihnen kommen, sondern verlegen in den Ecken schnüffeln und beschwichtigen. Wenden Sie sich etwas von ihrem Hund ab, gehen sie in die Hocke und rufen Sie ihn leise. Sie werden sehen, ihr Hund versteht Sie jetzt.

 

 

 

1. Can your dog read your mind?: Understanding the causes of canine perspective taking. Udell MA, Dorey NR, Wynne CD. Learn Behav. (2011)

2. Dogs‘ comprehension of referential emotional expressions: familiar people and familiar emotions are easier. Merola I, Prato-Previde E, Lazzaroni M, Marshall-Pescini S. Anim Cogn. (2013)

3. Contagious yawning in domestic dog puppies (Canis lupus familiaris): the effect of ontogeny and emotional closeness on low-level imitation in dogs. Elainie Alenkær Madsen, Tomas Persson. Anim Cogn (2013)

4.  Are readers of our face readers of our minds? Dogs (Canis familiaris) show situation-dependent recognition of human’s attention. Márta Gácsi, Ádám Miklósi, Orsolya Varga, József Topál, Vilmos Csányi. Anim Cogn (2004)

5 . Seeing Left- or Right-Asymmetric Tail Wagging Produces Different Emotional Responses in Dogs. Marcello Siniscalchi, Rita Lusito, Giorgio Vallortigarasend email, Angelo Quaranta. Current Biology (2013)

 

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Leben mit einem Angsthund

Juni 2015

Wie beim Menschen gibt es auch bei Hunden unterschiedliche Persönlichkeiten. Der eine ist eher mutig und der andere fürchtet sich vor allem. Bei einem von Geburt an gut sozialisierten Hund dürfte die Angst selten die Oberhand gewinnen. Anders sieht es bei Hunden mit einem sogenannten Deprivationssyndrom aus.

Deprivationssyndrom

Die Deprivation bei Hunden entsteht durch einen Mangel an sozialen Interaktionen und an Umweltreizen in der Kindheit des Hundes. Dieser Mangel kann verschiedene Ursachen haben und bei Hunden von Züchtern ebenso auftreten wie bei Tieren vom Tierschutz. Die meisten Züchter versuchen ihre Tiere sorgfältig, zusammen mit einer gut sozialisierten Mutterhündin, aufzuziehen. Diese Züchter werden aber kaum ein Tier zu Ramschpreisen oder ohne ordentlichen Vertrag abgeben. Aus diesem Grund nenne ich alle anderen einfachheitshalber Vermehrer. Bei Hunden von Vermehrern kann man sich fast sicher sein, einen Hund mit einer Angststörung zu erhalten.

Diese Vermehrerhunde kommen oft aus einer reizarmen Umgebung (Stall oder Keller) und werden viel zu früh vom Muttertier getrennt. Aber auch Hunde von der Strasse, die schlechte Erfahrungen mit den Menschen gemacht haben, können unter dem Deprivationssyndrom leiden, wenn sie dann in eine Familie kommen.

Solange der Hund seine gewohnte Umgebung nicht verlässt, fallen keine Probleme auf. Sobald der Hund aber in eine ungewohnte Umgebung kommt entwickelt er je nach Situation und Charakter ein Angstverhalten.

Umgehen mit Angstverhalten

Zuerst möchte ich an dieser Stelle mit einem Mythos aufräumen, der schon vielen Menschen und Hunden das Leben schwer gemacht hat:

 Das Märchen man solle Angst bei Hunden ignorieren.

Eltern im Tierreich beschützen und trösten den Nachwuchs in Angstsituationen. Gute Menscheneltern würden ihr Kind in den Arm nehmen und versuchen ihm die Situation zu erklären.

Der Hund ist ein soziales Lebewesen wie der Mensch. Warum sollte man ihn in mit seiner Angst alleine lassen? Wieso sollte das Ignorieren von Angst diese verschwinden lassen? Ein Hund der mit seiner Angst alleine ist, wird Strategien entwickeln damit auch alleine umzugehen. Wollen wir das?

Wenn wir das nicht wollen, müssen wir erst einmal herausfinden wovor der Hund Angst hat, wie seine Strategie ist und dann seine Strategie bei Angst in eine von uns gewünschte Richtungen lenken.

Was ist Angst?

Alle Lebewesen kennen Angst und die damit verbundenen Reaktionen. Angstreaktionen werden durch das Unterbewusstsein ausgelöst und müssen zum Überleben möglichst schnell erfolgen. In Sekundenbruchteilen kommt es bei Angst zu einer „Fight-or-flight-Reaktion„. Das Gehirn setzt  Adrenalin frei und zusätzlich können Hormone wie Cortisol gebildet werden.

Was diese Angstreaktion auslöst kann sehr unterschiedlich sein und bei angstgestörten Hunden sind dies oft unzählige Dinge und Situationen. Wenn man dies ignoriert, werden es immer mehr Situationen. Wollen wir also diese Angstreaktion verhindern, dürfen wir es gar nicht so weit kommen lassen.

Angstreaktion verhindern

Wenn Sie die Gegenstände oder Situationen kennen die bei Ihrem Hund eine Angstreaktion auslösen, meiden Sie diese erst einmal. Sie müssen Ihren Hund nicht in Watte packen, aber wenn Sie merken Ihr Hund fängt nervös an einen Gegenstand zu fixieren, zwingen Sie ihn nicht weiter. Die meisten Hunde können keine Leckerlies mehr annehmen vor Angst. Dies ist ein gutes Zeichen, dass Sie zu weit gegangen sind.

Angst vor Gegenständen oder Örtlichkeiten

Mit der Angst vor unbeweglichen Objekten ist relativ einfach zu üben. Vielleicht möchten Sie sich vorher mit dem Clickertraining vertraut machen. Positives Training bewirkt gerade bei Angsthunden oft Wunder. Mit Gewalt verschwindet keine Angst.

Gehen Sie mit ihrem Hund zu dem Gegenstand, der ihm Angst macht. Reden Sie mit ihm und beobachten Sie den Hund genau. Wenn die Angst zu groß wird, drehen Sie um, bis der Hund sich entspannt. Dann versuchen Sie es erneut, vielleicht können Sie ihr Reden mit Leckerlies unterstreichen. Sobald der Hund zu nervös wird drehen Sie um. Zwingen Sie den Hund zu nichts, auch nicht zum Umkehren. Lassen Sie ihn das Objekt in Ruhe anschauen, wenn er will. Wenn der Hund panisch in die andere Richtung rennt bleiben Sie einfach stehen. Rucken Sie nicht an der Leine und lassen Sie sich nicht vom Hund ziehen. Sobald der Hund nicht mehr zerrt, gehen Sie weiter. Aber nur mit lockerer Leine. Dies erfordert Ausdauer, Zeit und gute Nerven. Deshalb machen Sie diese Übung nur, wenn Sie genügend Zeit und Ruhe haben.

Oft bieten Hunde irgendwann bei dieser Übung verschiede Verhaltensweisen an, wie sie mit der Angst umgehen wollen. Unser Angst-Cody setzt sich gerne auf meinen Fuß und schaut. Dies ist eine Reaktion, die von mir erwünscht ist und wird sofort belohnt.

Diese Übungen müssen über Tage, Wochen oder auch Monate konsequent wiederholt werden. Bei festen Objekten ist dies relativ einfach. Schwieriger wird es mit beweglichen Objekten, die meist viel furchteinflössender sind weil sie oft laut sind und gerne bedrohlich mit den Hunden interagieren.

Angst vor Kindern

Kinder sind nicht nur laut, sondern schauen Hunden auch gerne in die Augen und greifen danach. Für einen Hund der nicht mit Kindern sozialisiert wurde ist dies alles der pure Horror. Falls Sie kleine Kinder haben und einen Hund mit einer Angststörung, möchte ich Ihnen ernsthaft raten sich umgehend mit dem Tierschutz in Verbindung zu setzen. Sie werden es unmöglich schaffen dem Hund und den Kindern gerecht zu werden. Geben Sie den Hund ab. Falls Sie ältere Kinder haben überlegen Sie es sich gemeinsam mit den Kindern, ob Sie das alles schaffen können.

Einen Hund der Angst vor Kindern hat, kann man wohl dosiert an die kleinen Menschen gewöhnen. Lassen Sie die Kinder den Hund am Anfang nicht anschauen, hier bewirkt Nichtbeachtung wahre Wunder. Auch Locken mit Leckerlies ist erst mal keine gute Idee. Hierfür agieren die Kinder viel zu direkt mit dem Hund. Machen Sie ein Spiel, das Kindern und Hund Spaß macht.

Zum Beispiel kann das Kind hinter sich eine Spur aus Futter auslegen. Dabei wendet es sich vom Hund ab, kann ihn füttern und sich irgendwann später sogar suchen lassen. Das Kind kann dem Hund Leckerlies in einer Pappschachtel verpacken (Klopapierrolle, Eierkarton etc.) und dies dann für den Hund hinter sich auf den Boden legen. Durch das Verpacken gewöhnt sich der Hund an den Geruch und bekommt dann eine Belohnung.

Falls Sie selten Besuch von Kindern bekommen, kann es eventuell erst mal reichen, wenn Sie um Kinder einen Bogen machen und Ihren Hund langsam daran gewöhnen wie oben bei den Objekten. Hierzu eignet sich ein Spielplatz hervorragend. Lassen Sie unter keinen Umständen ein Kind ihren Hund streicheln, auch wenn Sie sich ganz sicher sind dass der Hund nicht beisst. Ein Angsthund ist für fremde Menschen nicht zum Anfassen. Es ist ihre Aufgabe ihn davor zu beschützen.

Angst vor Menschen

Hier ist es ähnlich wie bei Kindern. Machen Sie auf der Strasse einen Bogen um Menschen, lassen Sie Fremde nie den Hund anfassen. Zeigen Sie Ihrem Hund, dass Sie ihn beschützen. Besuch sollte ebenso den Hund nicht mit Leckerlies locken. Auch Besuch kann diese hinter sich legen, wenn er gerne füttern will. Direkt interagieren ist für den Hund beängstigend. Deshalb sind Hundehasser bei ängstlichen Hunden sehr beliebt: Sie schauen den Hund nicht direkt an und interessieren sich nicht. Das ist für den Hund weniger furchteinflössend.

Es ist wichtig, dass ein Angsthund einen festen Rückzugsort im Haus hat. Einen Kennel, eine Kiste oder einfach nur unter einer Eckbank. An „seinen“ Ort sollte er jederzeit flüchten können und dort lässt man ihn in Ruhe.

Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

cody

Empfehlungen

Es gibt heute sehr gute Literatur zu diesem Thema und auch einige Hundeschulen die mit Angsthunden arbeiten. Achten Sie auf jeden Fall darauf, dass nicht mit Zwängen oder Strafe gearbeitet wird. Jedwedes Einschüchtern, Erschrecken oder pauschale Problemlösungen sollten vermieden werden. Gehen Sie individuell auf Ihren Hund ein und folgen Sie im Zweifelsfalle Ihrem Bauchgefühl. Sie wollen ja Spaß am Leben mit Ihrem Hund. Sie können das!

„Leben will gelernt sein“ von Wiebke Wagemann und Birgit Laser.

„Die stille Kommunikation der Hunde verstehen“ von Rosie Lowry

„Clickertraining“ von Birgit Laser

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Untersuchungen von Hundekot mit der Moticam

 

Giardia

Giardia intestinalis

 

nematode2

Fadenwürmer (vielleicht Hakenwürmer, Uncinaria stenocephala) und Bakterien

nematode

Fadenwurm 400-fach

nematode1

Fadenwürmer (vielleicht Hakenwürmer, Uncinaria stenocephala) und Bakterien

 Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

 

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

 

 

 

 

 

 

 

 

 

 

Defekt im MDR1 Gen bei Hunden

03.06.2015

Wer mehr über die Deletion im MDR1 Gen bei Hunden erfahren will, sei an Wikipedia oder Onkel Google verwiesen.

Übersicht der Hunderassen und die prozentuale Häufigkeit eines MDR1 (multi drug resistance)  Gendefekt (1)

Rasse Defekt (%) in beiden MDR1(-)
Collie 55 – 57
Langhaar Whippet 42
Sheltie 7– 35
Miniature Australian Shepherd 20 – 26
Silken Windhound 18
McNab 17
Australian Shepherd 17 – 46
Wäller 17 – 19
Weisser Schweizer Schäferhund 14
Bobtail 1 – 11
Englischer Schäferhund 7
Deutscher Schäferhund 6
Border Collie 1 – 2
Hütehund Mix 6 – 7
Mischlinge 2 – 7

Auswirkungen des Gendefektes

Der Gendefekt bewirkt ein nicht funktionales Protein names P-Glycoproteins. Dieses Protein ist für einige Transportvorgänge im Körper verantwortlich, vor allem zwischen Leber, Niere und Gehirn. Daher kommt es ohne das Protein zu einem höheren Transport von Nebennierenrindenhormonen und in Folge zu erniedrigten Kortisolwerten im Blut. Es wird auch vermutet, dass durch das Fehlen des P-Glycoproteins eine höhere Anfälligkeit für chronisch entzündliche Darmerkrankungen besteht. (2)

MDR heisst deshalb „multi drug resistance“ weil es als Schutzprotein für die Blut-Hirn-Schranke eine Art Barriere für Arzneimittel darstellt.  Da bei Hunden mit dem Gendefekt der Schutz entfällt können neurotoxische Nebenwirkungen auftreten falls es zur Aufnahme bestimmter Arzneimittel kommt.

Diese Arzneimittel sind in manchen Wurmkuren (vor allem der für Pferde) und in Flohschutzmitteln vorhanden. Aus glaubhaften Quellen aus den USA wird berichtet, dass Hunde am Verzehr von kürzlich entwurmten Pferdekot gestorben sind (3).

Folgende Inhaltsstoffe von Arzneimitteln können je nach Dosis für diese Hunde gefährlich werden:

Acepromazine
Butorphanol
Doxorubicin
Erythromycin
Ivermectin
Ioperamide
Milbemycin
Moxidectin
Rifampin
Selamectin
Vinblastine
Vincristine 

(Liste nach 3*)

MDR1 ist ein patentiertes Gen

Am 18.11.2009 ist ein Patent auf das MDR1 Gen und seine Deletion in Kraft getreten. Es ist also bis 2029 in Deutschland unter Strafe verboten ohne Lizenz auf das MDR1 Gen aller Hunde zu schauen. Falls also jemand seinen Hund auf eine MDR1 Gen Mutation testen lassen will, soll er sich an den Lizenzinhaber oder ein Labor im patentfreien Ausland wenden.

Bei folgender Analyse handelt es sich nicht um eine MDR1 Diagnostik. Ich habe lediglich einen bestimmten Abschnitt des Chromosom 14 von Hunden untersucht. Die angewandte Methode ist bei Keijor et al. (4) unter „Mutagenically separated PRC method“ beschrieben.

 Einblick in das Chromosom 14 von Hunden

Um einen Einblick in das Chromosom 14 von Hunden zu bekommen, habe ich einen kleinen Abschnitt per PCR vervielfältigt und die Stücke in einem Gel angeschaut.

Gel

 

Die DNA Fragmente werden angefärbt, in ein Agarosegel geladen und nach der Elektrophorese auf einem Trasilluminator sichbar gemacht.

 

 

 

MDR

Agarosegel mit den PCR Produkten
lane1: Größenmarker
lane2: Abschnitt vom Chromosom 14 von Lara
lane3: Abschnitt vom Chromosom 14 von Cody
lane4: Abschnitt vom Chromosom 14 von Niki

MDR1

Agarosegel mit den PCR Produkten
Bina: Abschnitt ohne Deletion (+/+)
Beni: Abschnitt ohne Deletion (+/+)
Amica: Abschnitt ohne Deletion (+/+)
Ibo: Abschnitt ohne Deletion (+/+)

 

 

 

 

 

 

 

Falls ein Hund eine Deletion im Chromosom 14 hätte, würde das PCR Produkt des betroffenen Chromosoms nur 107 Basenpaare groß sein. Die hier untersuchten Hunde haben also keinen Defekt im MDR1 Gen.

Da die MP (Mutagenically seperated) PCR nur mit einer bestimmten Taq Polymerase funktioniert, wurde aus der selben Veröffentlichung eine direkte PCR mit einer anderen Polymerase durchgeführt. Bei der direkten PCR entsteht ein 60 bp großes Fragment bei Hunden ohne Deletion. Bei einer Deletion müsste ein 56 bp großes Fragement entstehen. Hier wurde die PCR mit zum Teil schon getesteten Hunden durchgeführt. Alle Hunde haben anscheinend keine Deletion und sind wohl +/+.

picmonkey_image

 

Alle Hunde sind Mischlinge und stammen aus dem Tierschutz. Lara, Bina und Ibo sind Colliemixe, bzw. Australien Shepherd.

Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

(1) Treatment of MDR1 Mutant Dogs with Macrocyclic Lactones. Joachim Geyer und Christina Janko. Curr Pharm Biotechnol. (2012)

(2) Comparison of the hypothalamic-pituitary-adrenal axis in MDR1-1Δ and MDR1 wildtype dogs. Katrina L. Mealey et al.: Journal of Veterinary Emergency and Critical Care. (2007)

(3) Problems with Dog Medications and the MDR1 Gene. Deb Eldredge. http://www.dogchannel.com (2013)

(4) Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs. Mizukami , Chang HS, Yabuki A, Kawamichi T, Hossain MA, Rahman MM, Uddin MM, Yamato O: J Vet Diagn Invest. (2012)

 

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Ein forensischer Ansatz zur Bestimmung von Pelz-Decor

14.04.2015 / 21.08.2016 aktualisiert

Normalerweise beschäftigt sich die Forensik hauptsächlich mit Verbrechen rund um den Menschen und menschlicher DNA. Seit der VERORDNUNG DES EUROPÄISCHEN PARLAMENTS UND DES RATES über ein Verbot des Inverkehrbringens sowie der Ein- und Ausfuhr von Katzen- und Hundefellen sowie von Produkten, die solche Felle enthalten, in die bzw. aus der Gemeinschaft und deren Inkrafttreten am 01.01.2009, wird Katzen- und Hundefell gerne als Kaninchenfell oder auch als „fake fur“ falsch deklariert.

Das Europäische Parlament hat schon im Vorfeld der Verordnung die Problematik erkannt: Da Felle von Katzen und Hunden außerdem billiger sind als andere Pelzarten und als Ersatz für teurere Pelzarten genutzt werden können, stellt dies einen Anreiz zu unlauteren oder betrügerischen Praktiken dar; hierzu zählen falsche oder irreführende Angaben bei der Etikettierung ebenso wie andere Praktiken, die verschleiern sollen, um welche Produkte es sich eigentlich handelt und woher sie stammen. (1)

GESAMTEINFUHREN GEGERBTER PELZFELLE IN DIE EU-25-LÄNDER in Tonnen (1)

Jahr

Gesamteinfuhren

Aus China

Hauptausfuhrland

1998

3780,4

531,5

China

2005

4051,8

1295,6

China

GESAMTEINFUHREN VON BEKLEIDUNG, BEKLEIDUNGSZUBEHÖR UND SONSTIGEN WAREN gemäß KN- Code 4303 IN DIE EU-25-LÄNDER in Tonnen (1)

Jahr

Gesamteinfuhren

Aus China

Hauptausfuhrland

1998

1985,5

890,2

China

2005

3001,6

2128

China

Um das Tier zu bestimmen, von dem das Fell stammt, gibt es verschiedene Möglichkeiten: Mikroskopie, DNA-Tests und die MALDI-TOF-Massenspektrometrie. Da die Felle im Handel meist gegerbt und gefärbt sind, ist eine Isolierung von mitochondrialer DNA eine Herausforderung. Es gibt inzwischen aber viel Erfahrung mit antiker DNA und auch mit verarbeitetem Pelz. Gerade aus Italien, wo der Handel mit Pelzen schon lange strengen Verordnungen unterliegt, gibt es sehr gute Veröffentlichungen. So im Jahre 2014 von Pilli et al.: Pet fur or fake fur? A forensic approach (2).

IMG_2103

Da man zur Massenspektrometrie ein teures Gerät benötigt, habe ich mich hier auf die Mikroskopie und DNA-Tests beschränkt.

Mikroskopische Aufnahmen von Tierhaaren

IMG_0272

Kaninchenhaare

rabbit

Kaninchenhaare

 

 

 

 

 

 

cat

Katzenhaar

cat

Katzenhaar

 

 

 

 

 

 

Lara2

Hundehaar

Lara3

Hundehaar

 

 

 

 

 

 

IMG_0273

Pelzbesatz unbekannter Herkunft. (Kaninchen)

IMG_0270

Unbekannter Pelzbesatz von einem alten Schuh (Kaninchen)

 

fake 10er

Kunsthaar mit 100er Vergrößerung

rabbit 10er

Kaninchenhaar mit 100er Vergrößerung

 

 

 

 

 

 

 

 

 

 

 

 

PCR mit Tierhaaren

150323 cdr

Tierspezifische PCR
lane 1: Katze
lane 2: Hund
lane 3: Kaninchen

 

Bestimmung von tierspezifischen Abschnitten auf der mitochondrialen DNA (mtDNA).

Das amplifizierte Fragment aus mitochondrialer DNA  von Katzen ist 180 bp, von Hunden 153 bp und von Kaninchen 209 bp.

 

 

150323

lane 1: Marker
lane 2: Katzen DNA mit Katzenprimer
lane 3: Hunde DNA mit Hundeprimer
lane 4: Kaninchen DNA mit Katzenprimer
lane 5: Kaninchen DNA 1. PCR Kaninchenprimer
lane 6: Kaninchen DNA mit Hundeprimer
lane 7: Kaninchen DNA Kaninchenprimer 1. PCR
lane 8: Kaninchen DNA aus lane 7 und 2. PCR mit nested Kaninchenprimer

 

 

 

Da die Größenunterschiede in einem Agarosegel schlecht zu sehen sind, habe ich auch noch ein Polyacryamidgel gemacht.

PAC

PCR mit verschiedenen Tierhaaren
lane1: Größenmarker
lane2: Katzenhaar
lane3: Hundehaar
lane4: Katzenhaar
lane5: Haar von altem Schuh
lane6: Kaninchenhaar
lane7-9: Hundehaar

Wie gut diese Methode bei weiteren gegerbten und gefärbten Tierhaaren funktioniert, wird die Zukunft zeigen.

Untersuchung einer Kette mit angeblichem Kunstpelz

Diese Kette mit Pelzbesatz wurde als Kunstpelz verkauft.

CIMG6564

Kette mit angeblichem Kunstpelz

xy3 10

100er Vergrößerung zeigt, dass es sich um Echtpelz handelt. (Katze)

xy2

Tierhaar unbekannt (400er Vergrößerung)

xy1

Tierhaar unbekannt (Katze)

 

 

 

 

 

 

Camus

Katzenhaar aus Unterwolle (400er Vergrößerung)

rabbit2

Kaninchenhaar (400er)

rabbit1

Kaninchenhaar (400er)

fake

Kunstpelz (400er)

Mit dem Fell  wurde eine PCR mit den Katzenprimern gemacht.

PCR

PCR zeigt in lane 3 ein Produkt mit 180 bp

Das Fell sieht nicht nur unter dem Mikroskop aus wie Katzenfell, die PCR bestätigt auch DNA von Katzen an dem Fell.

 

Material und Methoden

In forensischen Analysen haben sich mitochondriale DNA Marker durchgesetzt. Mitochondriale DNA (mtDNA) ist innerhalb einer Spezies sehr gut konserviert und es gibt pro Zelle mehrere Kopien. Auch besitzen Mitochondrien noch eine zusätzliche Proteinhülle, sodass ihre DNA besser vor Degradationen geschützt ist. Innerhalb der mtDNA benutzt man heute cytrochrome b oder cytochrome c oxidase Marker (2). Deshalb wurden hier für die PCR Primer benutzt, die zwischen 150 und 300 Basenpaare (bp) der mtDNA eine definierte Spezies erkennen.

Extraktion von mitochondrialer DNA

Da in meinem Labor grundsätzlich kein Phenol oder andere giftigen Chemikalien benutzt werden, habe ich mich für verschiedene Salzfällungen entschieden.

1-2 Tierhaare wurden in 400 µl Puffer HS (10 mM Tris pH7.6, 10 mM KCl, 10 mM MgCl, 0,4 M NaCl, 2 mM EDTA), 10 µl DTT (1M), 10 µl Proteinase K und 50 µl 10% SDS über Nacht bei 55°C inkubiert. Am nächsten Morgen wurde mit 300 µl NaCl (5M) für 20 Minuten bei 12000 rpm die 1. Salzfällung durchgeführt. Aus dem Überstand wurde die DNA mit Isopropanol ausgefällt und mit 70% EtOH gewaschen. Danach wurde die DNA für 1 Stunde mit RNAse behandelt und eine 2. Salzfällung mit 300 mM Natriumacetat für 1h bei -20°C und anschließender Zentrifugation bei 12000 rpm für 20 Minuten durchgeführt. Die DNA wurde anschließend mit EtOH ausgefällt und gewaschen.

Primer für die PCR

Hund mtDNA: GAACTAGGTCAGCCCGGTACTT und CGGAGCACCAATTATTAACGGC
Produkt: 153bp
Katze mtDNA:TTCTCAGGATATACCCTTGACA und GAAAGAGCCCATTGAGGAAATC
Produkt: 180bp
Kaninchen mtDNA: AATCAAATAACAACTAAGCTGTA und TATAAAGCACCGCCAAGT 1.PCR
AATCAAATAACAACTAAGCTGTA und GCCAAGTCCTTTGAGTTTTA 2. PCR
Produkt 209bp

Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

 

(1) DAS EUROPÄISCHE PARLAMENT UND DER RAT DER EUROPÄISCHEN UNION, gestützt auf den Vertrag zur Gründung der Europäischen Gemeinschaft, insbesondere auf die Artikel 95 und 133, auf Vorschlag der Kommission, nach Stellungnahme des Europäischen Wirtschafts- und Sozialausschusses, gemäß dem Verfahren des Artikels 251 EG-Vertrag5, HABEN FOLGENDE VERORDNUNG ERLASSEN: http://ec.europa.eu/food/animal/welfare/cat_dog_fur_proposal_de.pdf

(2) Pet fur or fake fur? A forensic approach: Elena Pilli, Rosario Casamassima, Stefania Vai, Antonio Virgili, Filippo Barni, Giancarlo D’Errico, Andrea Berti, Giampietro Lago, David Caramelli. Investigative Genetics 5:7 (2014)


Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Der Rebell in den Appalachen von Kentucky

25.11.2013

Kentucky

Sicher vor der Welt versteckt liegt, neben einem sprudelnden Bach, in einem abgeschiedenen Tal das von den bewaldeten, hügeligen Wäldern der Appalachen des östlichen Kentucky umgeben ist, das etwa 80 Hektar große Schutzgebiet der Trixie-Stiftung „Eden“ von meinem Freund Randy Skaggs.

4

Die Trixie Foundation bietet seit über 23 Jahren hunderten an Tieren einen geistigen und emotionalen Ort der Zufriedenheit und Ruhe  –  Essen, Schutz, Geborgenheit und Liebe für weggeworfene, misshandelte und verängstigten Tiere aller Art.  

23

20

Die Reise von Randy Skaggs begann 1987, als er mit sieben geretteten Hunden plötzlich obdachlos wurde. Nicht bereit, seine Hunde aufzugeben oder sich Zwängen zu unterwerfen, bestimmt er sein eigenes Schicksal in einer kleinen Hütte die er in den Bergen der Appalachen von Kentucky fand.

9

8

Mit dabei war auch Trixie, die Namensgeberin der Stiftung. Trixie, ein Norwegischer Elchhund, wurde als Baby mit 6 Wochen zum Sterben, mit einem Loch im Rücken, weggeworfen. Randy hatte sie gesund gepflegt und sie wurde für viele Jahre ein geliebte Begleiterin. Als Trixie auf tragische Weise ums Leben kam, schwor Randy sich in Trixies Namen, um unerwünschte, verlassene und missbrauchte Tiere zu kümmern. An diesem kalten und tristen winterlichen Nachmittag des 22. Januar 1990 begann Randy die Trixie-Stiftung.

Trixie

 

 

Trixie sollte das Fundament dafür sein, was alle Tiere verdienen: Ein gutes Leben.

 

 

 

19

 

Schnell verbreitete sich das Engagement von Randy Skaggs und es leben bald über 100 verlassene und entsorgte Tiere bei ihm.21

Es ist im sehr ländlich geprägten Osten von Kentucky nicht einfach einen solchen Ort zu unterhalten und die kommunalen Regierungen ignorieren das Leid der Tiere oder noch schlimmer, entsorgen sie. Wir kennen ähnliche Geschichten aus Europa.

13

 

Wie schafft es ein Mann fast 300 unerwünschten, obdachlosen, missbrauchten, vernachlässigten, hungernden Hunden und Katzen 24 Stunden am Tag eine liebevolle und käfigfreie Betreuung, Pflege und eine sichere Umgebung zu schenken?

 

 

Randy Skaggs schreibt. Ich denke, wann immer es seine Zeit zulässt, schreibt er. Nicht nur für Spenden, er engagiert sich in ganz Kentucky,  schreibt öffentliche Anfragen, Briefe an Ausschüsse, Hinweise, Appelle an die Generalstaatsanwaltschaft. Er überprüft Dokumente auf Hinweise zu Richtlinien und Verfahren. Im Jahr 2000 reichte die Trixie-Stiftung eine Sammelklage  wegen Nichtumsetzung des Tierschutzes ein.

16

Mit vielen Helfern und Spenden gleicht das Gelände heute einem wirklichen Eden. Die Hunde werden in Rudeln gehalten. Keiner wird eingesperrt. Es gibt Schutzhütten und Katzenhäuser, Kastrationen, Impfungen und genug Futter für alle.

18

17

Vielleicht planen Sie einen Urlaub in die wunderschönen Appalachen und Sie möchten etwas erleben und das wirkliche Kentucky spüren, dann besuchen Sie doch einfach die Trixie Stiftung. Natürlich gibt es auch viele Geschichten über die Trixie Foundation im Internet zu entdecken.

Hier ist die offizielle Seite: http://thetrixiefoundation.org/

14