Category Archives: Methoden

DNA Extraktion und 16S PCR Schnecken

30.07.2020

Malakazoologen sind diejenigen, die Schnecken bestimmen und untersuchen. Leider sind diese Zoologen bis heute eher Schnecken Leichenfledderer und „Häuslesammler“. Jetzt wollte ich aber unsere einheimischen Schnecken bestimmen und fotografieren, ohne diese irgendwie zu stören.
So kam mir die Idee, nach meinen umfassenden Untersuchungen mit dem Alpenveilchen, bei den Schnecken ebenso mit der DNA zu arbeiten.

Durch Recherche fand ich, dass es eine umfassende Datenbank auf NCBI gibt über 16S als Marker für verschiedene Schnecken (1).

In meinem Labor benutze ich grundsätzlich keine giftigen Chemikalien wie Phenol, Mecaptoethanol oder Chloroform, die man normaler Weise zum Aufreinigen von DNA verwendet. Deshalb habe ich ein Protokoll entwickelt, das für Schnecken funktioniert ohne diese auf irgend eine Weise zu verletzten oder diese Chemikalien zu verwenden.

Dann haben Schnecken viele Polysaccharide, sogenannte Mucopolysaccharide und auch Glycogen. Diese können die PCR stören oder auch die DNA zum scheren bringen. Wenn die DNA geschert ist, erkennt man dies an „Wölkchen“ als PCR Produkt. Fall kein PCR Produkt erscheint, ist es auch möglich, dass die DNA nicht in Lösung ging und noch im Eppi klebt.

Ich habe ziemlich viel Zeit in dieses Protokoll investiert und will es hier gerne mit interessierten Menschen teilen.

Extraktion von DNA aus Schnecken ohne Phenol und ohne Chloroform

Schnecke auf Swab

Ausgangsmaterial ist ein Abstrich mit einem Wattestab (Swab).

Hierbei wird sich die Schnecke zurück ziehen, das macht aber nichts.

Dann kommt der Kopf vom Swab in ein Eppi. Ich schneide oft nur den Teil der Watte ab der mit der Schnecke in Berührung kam. Hier ist aber äußerste Vorsicht geboten, da eine Kontamination mit menschlicher DNA hier durchaus möglich ist.

Je Eppi nehme ich 800 µl WB Buffer, plus 20 µl DTT, plus 20 µl Proteinase K. Der Puffer mit der Watte kann hier bei -20° Grad weggefroren werden für eine spätere Extraktion.

WB Buffer

100 mM TrisHCl pH 7.6
5 mM EDTA
350 mM Sorbitol
1 % PVP 40
2 % CTAB
2 M Na Cl

Dieser Schritt ist für viele Schneckenarten essentiell!

Das Sorbitol verbindet sich mit den Mucopolysacchariden und das PVP Polyvinylpyrrolidone (molweight 40000) entfernt die Polyphenole.

Dies alles wird gut gemischt. Wenn das Eppi mit dem Puffer und der DNA erst aufgetaut werden soll, dann stelle ich dies kurz auf den Heizblock bei 60°C. Dann kommt der Waschschritt:

Das Eppi kommt bei 8000 rpm für 10 Minuten in die Zentrifuge.

Danach schwimmt wohl das Sorbitol mit den Mucopolysacchariden und das PVP mit den Polyphenolen oben und die DNA mit CTAB befindet sich unten.

Also pipettiert man diese oben weg. Dies mache ich nach Gefühl, so etwa die oberen 500 µl der Lösung kommen weg.

Auf die Watte und den unteren Teil kommt dann 800 µl EB, plus 50 µl SDS (10 %) plus 20 µl DTT, plus 20 µl Proteinase K.

EB Buffer

10 mM TrisHCl pH 7.6
10 mM KCl
10 mM MgCl2
400 mM NaCL
2 mM EDTA
1 % CTAB
1 % PVP40

CTAB Puffer löst man am besten über Nacht und nicht zu stark schütteln, schäumt! Das SDS im EB Puffer trübt den Puffer ein, ist aber kein Problem, im Heizblock wird der Puffer wieder klar.

Proteinase K

20 mg/ml in 100mM Tris pH 8,6, 6 mM CaCl2, 50% Glycerin. Lagern bei -20°C.

Proteinase K ist am meisten aktiv bei 65°C mit SDS und sollte mindestens 1x im Jahr neu angesetzt und alliquotiert werden.

DTT

1 g DTT in 6,5 ml H2O oder 1M. Aliquotieren und bei  -20°C lagern. DTT oxidiert schnell, deshalb lieber öfters neu machen. DTT ist ein Reduktionsmittel für Disulfidbindungen

Das Eppi mit EB, SDS, DTT, und Proteinase K wird vorsichtig gemischt und kommt bei 60°- 65°C für vier Stunden in den Heizblock. Ab- und an das Eppi bisschen bewegen und mischen, aber nicht zu doll, sonst kann die DNA scheren. Ich hatte es auch schon deutlich länger auf dem Heizblock und danach bei Raumtemperatur (2 Tage), ohne nennenswerte Verluste.

Nach dem Verdau werden 700 µl abpittetiert – diesmal möglichst von unten. Dies kommt mit 600 µl Isopropanol in ein neues Eppi und wird vorsichtig gemischt. Das alles bei Raumtemperatur! Dann wird die DNA 60 Sekunden bei 10 K rpm abzentrifugiert (gerne auch mehr, kann ich aber nicht). Nicht zu lange oder zu kalt, sonst kommt unerwünschtes irgendwas mit oder das Pellet lässt sich nur schwer wieder lösen.

Danach kann man das Pellet mit 70% kaltem EtOH waschen und trocknen. Ich trockne immer ein paar Stunden auf der Bench. Lösen tu ich es mit etwa 50 µl Bidest meist über Nacht auch auf der Bench.

Falls die PCR später nicht funktioniert, kann das am ehesten an der DNA liegen. Natürlich nur, wenn man sich mit den Primern sicher ist. Hier empfiehlt sich eine positiv Kontrolle. Probleme mit der DNA kann z.B. von der Proteinase K kommen. Meiner Erfahrung nach kann man da mit der Konzentration und der Verdauzeit eher hoch gehen, als runter.  RNAse benutze ich meistens keine.

Dann wieder die Mucopolysaccharide, Polyphenole und auch Glycogen. Diese können die PCR stören oder auch die DNA zum scheren bringen. Wenn die DNA geschert ist, erkennt man dies an „Wölkchen“ als PCR Produkt. Hier muss man nochmal alles neu machen. Vielleicht einen 2. Schritt mit dem WB einfügen. Falls kein PCR Produkt erscheint, ist es auch möglich, dass die DNA nicht in Lösung ging und noch im Eppi klebt.

1 lane 16 S PCR Produkt lane 2-4 „Wölkchen“ mit gescherter DNA


PCR der 16S mitochondrialen rDNA von Schnecken

16S Produkt ist etwa 400 bp groß

Die Primer sind alt bekannt und wurden 1991 von Palumbi veröffentlicht (2). Ich habe sie allerdings etwas modifiziert:

HM103f – CGCCTGTTTATCAAAAACAT
HM104r – CCGGTCTGAACTCAGAT

PCR: 35 cycles mit annealing 54°C und Phusion Taq (NEB)

Die Bande wird ausgeschnitten, mit dem Monarch DNA kit von New England Labs aufgereinigt, bei GATC in Köln mit Primer HM103 sequenziert und die Sequenz mit NCBI Blast abgeglichen.

Hier das Ergebnis mit meinem ersten Versuch, der oben abgebildeten Posthornschnecke.


(1) Razkin et al., Molecular phylogeny of the western Palaearctic Helicoidea (Gastropoda, Stylommatophora). Molecular Phylogenetics and Evolution, Volume 83, Pages 99-117 (2015)

(2) Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., The Simple Fool’s Guide to PCR, Version 2.0. Department of Zoology, University of Hawaii, Honolulu, HI. (1991)

(3) Jean-René Arseneau, Royce Steeves, Mark Laflamme, Modified low-salt CTAB extraction of high-quality DNA from contaminant-rich tissues. Mol Ecol Resour (2017) DOI: 10.1111/1755-0998.12616

(4) Peter W. Inglis, Marilia de Castro R. Pappas, Lucileide V. Resende, Dario Grattapaglia, Fast and inexpensive protocols for consistent extraction of high quality DNA and RNA from challenging plant and fungal samples for high-throughput SNP genotyping and sequencing applications, PLOS one (2018) https://doi.org/10.1371/journal.pone.0206085

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


DNA Extraktion aus Blättern

Mai 2017

Die Isolation von genomischer DNA (gDNA), chloroplasten DNA (cpDNA) oder auch mitochondrialer DNA (mt) aus Pflanzen ist nicht ganz so einfach. Pflanzen produzieren eine unüberschaubare Menge an sekundären Inhaltsstoffen wie Glykoside, Polyphenole, Xanthone, Phenylpropanoide, Terpene, Steroide, Carotinoide, Speicherlipide und Alkaloide. Diese können die DNA zerstören oder auch eine nachfolgende PCR behindern.

In meinem Labor benutze ich grundsätzlich keine giftigen Chemikalien wie Phenol, Mecaptoethanol oder Chloroform, die man normaler Weise zum Aufreinigen von DNA verwendet. Deshalb habe ich ein Protokoll entwickelt, das für das Alpenveilchen funktioniert und genug saubere DNA für eine PCR abwirft. Ich habe ziemlich viel Zeit in dieses Protokoll investiert und will es hier gerne mit interessierten Pflanzengenetikern teilen:

Extraktion von DNA aus Blättern von Cyclamen ohne Phenol

Ausgangsmaterial ist ein kleines Stück von einem jungen Blatt ohne Adern. Es sollten nicht mehr als 50 mg sein. Dieses Blatt wird zerkleinert. Man kann dazu einen herkömmlichen Mörser nehmen und mörsert am besten mit flüssigem Stickstoff. Wenn dies nicht vorhanden ist, geht auch solch ein blauer Plastikmöppel ohne Stickstoff. Nur sollte man sich dabei beeilen und möglichst im Puffer zerkleinern. Der blaue Plastikmöppel heißt „Micro Pestel“.

Je Eppi nehme ich 800 µl HS Buffer, plus 100 µl SDS (10%), plus 20 µl DTT, plus 40  µl Proteinase K und plus 20 µl RNAse.

HS Buffer

10 mM TrisHCl pH 7.6
10 mM KCl
10 mM MgCl2
400 mM NaCL
2 mM EDTA

Proteinase K

20 mg/ml in 100mM Tris ph 8,6,, 6mM CaCl2, 50% Glycerin. Lagern bei -20°C

DTT

5 g DTT in 32,4 ml H2O oder 1M. Bei  20°C lagern.

Das ganze wird vorsichtig gemischt und kommt bei 50°C für zwei Stunden in den Heizblock. Kein Vortex! Das Eppi nur kurz invertieren, nicht zu doll mixen, da die DNA leicht schert. Ab- und an das Eppi bisschen bewegen.

Dann kommt das Eppi für 3 Minuten in die Zentrifuge mit Vollspeed. 700 µl vom Überstand kommen  mit 600 µl Isopropanol in ein neues Eppi und werden vorsichtig gemischt. Das alles bei Raumtemperatur! Dann wird die DNA 5 Minuten bei 12 K rpm abzentrifugiert. Nicht zu lange oder zu kalt, sonst kommt unerwünschtes irgendwas mit.

Danach kann man das Pellet 2 x mit 70% EtOH waschen, trocknen und eine PCR versuchen. Mit viel Glück ist es schon sauber genug.

Für genomische DNA nehme ich das Pellet in Lysis Buffer auf und befolge das Protokoll von Roth. Gerade wenn man die DNA länger lagen will, empfiehlt sich eine bessere Aufreinigung. Hier wurde das Roti-Prep Genomic Kit von Roth benutzt, damit die DNA auch über Säulchen aufgereinigt ist. Aber Vorsicht, wenn man Chloroplasten oder Mitochondien DNA will, diese nicht mit Säulchen für gDNA aufreinigen.

Falls die PCR später nicht funktioniert, kann das am ehesten an der DNA liegen. Natürlich nur, wenn man sich mit den Primern sicher ist. Hier empfiehlt sich eine positiv Kontrolle. Probleme mit der DNA kommt oft von der Proteinase K. Meiner Erfahrung nach kann man da mit der Konzentration und der Verdauzeit eher hoch gehen, als runter.  Wichtig ist auch ein guter RNA Verdau. RNA kann auch die PCR stören.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Untersuchungen von Hundekot mit der Moticam

 

Giardia

Giardia intestinalis

 

nematode2

Fadenwürmer (vielleicht Hakenwürmer, Uncinaria stenocephala) und Bakterien

nematode

Fadenwurm 400-fach

nematode1

Fadenwürmer (vielleicht Hakenwürmer, Uncinaria stenocephala) und Bakterien

 Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

 

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

 

 

 

 

 

 

 

 

 

 

Defekt im MDR1 Gen bei Hunden

03.06.2015

Wer mehr über die Deletion im MDR1 Gen bei Hunden erfahren will, sei an Wikipedia oder Onkel Google verwiesen.

Übersicht der Hunderassen und die prozentuale Häufigkeit eines MDR1 (multi drug resistance)  Gendefekt (1)

Rasse Defekt (%) in beiden MDR1(-)
Collie 55 – 57
Langhaar Whippet 42
Sheltie 7– 35
Miniature Australian Shepherd 20 – 26
Silken Windhound 18
McNab 17
Australian Shepherd 17 – 46
Wäller 17 – 19
Weisser Schweizer Schäferhund 14
Bobtail 1 – 11
Englischer Schäferhund 7
Deutscher Schäferhund 6
Border Collie 1 – 2
Hütehund Mix 6 – 7
Mischlinge 2 – 7

Auswirkungen des Gendefektes

Der Gendefekt bewirkt ein nicht funktionales Protein names P-Glycoproteins. Dieses Protein ist für einige Transportvorgänge im Körper verantwortlich, vor allem zwischen Leber, Niere und Gehirn. Daher kommt es ohne das Protein zu einem höheren Transport von Nebennierenrindenhormonen und in Folge zu erniedrigten Kortisolwerten im Blut. Es wird auch vermutet, dass durch das Fehlen des P-Glycoproteins eine höhere Anfälligkeit für chronisch entzündliche Darmerkrankungen besteht. (2)

MDR heisst deshalb „multi drug resistance“ weil es als Schutzprotein für die Blut-Hirn-Schranke eine Art Barriere für Arzneimittel darstellt.  Da bei Hunden mit dem Gendefekt der Schutz entfällt können neurotoxische Nebenwirkungen auftreten falls es zur Aufnahme bestimmter Arzneimittel kommt.

Diese Arzneimittel sind in manchen Wurmkuren (vor allem der für Pferde) und in Flohschutzmitteln vorhanden. Aus glaubhaften Quellen aus den USA wird berichtet, dass Hunde am Verzehr von kürzlich entwurmten Pferdekot gestorben sind (3).

Folgende Inhaltsstoffe von Arzneimitteln können je nach Dosis für diese Hunde gefährlich werden:

Acepromazine
Butorphanol
Doxorubicin
Erythromycin
Ivermectin
Ioperamide
Milbemycin
Moxidectin
Rifampin
Selamectin
Vinblastine
Vincristine 

(Liste nach 3*)

MDR1 ist ein patentiertes Gen

Am 18.11.2009 ist ein Patent auf das MDR1 Gen und seine Deletion in Kraft getreten. Es ist also bis 2029 in Deutschland unter Strafe verboten ohne Lizenz auf das MDR1 Gen aller Hunde zu schauen. Falls also jemand seinen Hund auf eine MDR1 Gen Mutation testen lassen will, soll er sich an den Lizenzinhaber oder ein Labor im patentfreien Ausland wenden.

Bei folgender Analyse handelt es sich nicht um eine MDR1 Diagnostik. Ich habe lediglich einen bestimmten Abschnitt des Chromosom 14 von Hunden untersucht. Die angewandte Methode ist bei Keijor et al. (4) unter „Mutagenically separated PRC method“ beschrieben.

 Einblick in das Chromosom 14 von Hunden

Um einen Einblick in das Chromosom 14 von Hunden zu bekommen, habe ich einen kleinen Abschnitt per PCR vervielfältigt und die Stücke in einem Gel angeschaut.

Gel

 

Die DNA Fragmente werden angefärbt, in ein Agarosegel geladen und nach der Elektrophorese auf einem Trasilluminator sichbar gemacht.

 

 

 

MDR

Agarosegel mit den PCR Produkten
lane1: Größenmarker
lane2: Abschnitt vom Chromosom 14 von Lara
lane3: Abschnitt vom Chromosom 14 von Cody
lane4: Abschnitt vom Chromosom 14 von Niki

MDR1

Agarosegel mit den PCR Produkten
Bina: Abschnitt ohne Deletion (+/+)
Beni: Abschnitt ohne Deletion (+/+)
Amica: Abschnitt ohne Deletion (+/+)
Ibo: Abschnitt ohne Deletion (+/+)

 

 

 

 

 

 

 

Falls ein Hund eine Deletion im Chromosom 14 hätte, würde das PCR Produkt des betroffenen Chromosoms nur 107 Basenpaare groß sein. Die hier untersuchten Hunde haben also keinen Defekt im MDR1 Gen.

Da die MP (Mutagenically seperated) PCR nur mit einer bestimmten Taq Polymerase funktioniert, wurde aus der selben Veröffentlichung eine direkte PCR mit einer anderen Polymerase durchgeführt. Bei der direkten PCR entsteht ein 60 bp großes Fragment bei Hunden ohne Deletion. Bei einer Deletion müsste ein 56 bp großes Fragement entstehen. Hier wurde die PCR mit zum Teil schon getesteten Hunden durchgeführt. Alle Hunde haben anscheinend keine Deletion und sind wohl +/+.

picmonkey_image

 

Alle Hunde sind Mischlinge und stammen aus dem Tierschutz. Lara, Bina und Ibo sind Colliemixe, bzw. Australien Shepherd.

Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

(1) Treatment of MDR1 Mutant Dogs with Macrocyclic Lactones. Joachim Geyer und Christina Janko. Curr Pharm Biotechnol. (2012)

(2) Comparison of the hypothalamic-pituitary-adrenal axis in MDR1-1Δ and MDR1 wildtype dogs. Katrina L. Mealey et al.: Journal of Veterinary Emergency and Critical Care. (2007)

(3) Problems with Dog Medications and the MDR1 Gene. Deb Eldredge. http://www.dogchannel.com (2013)

(4) Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs. Mizukami , Chang HS, Yabuki A, Kawamichi T, Hossain MA, Rahman MM, Uddin MM, Yamato O: J Vet Diagn Invest. (2012)

 

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Ein forensischer Ansatz zur Bestimmung von Pelz-Decor

14.04.2015 / 21.08.2016 aktualisiert

Normalerweise beschäftigt sich die Forensik hauptsächlich mit Verbrechen rund um den Menschen und menschlicher DNA. Seit der VERORDNUNG DES EUROPÄISCHEN PARLAMENTS UND DES RATES über ein Verbot des Inverkehrbringens sowie der Ein- und Ausfuhr von Katzen- und Hundefellen sowie von Produkten, die solche Felle enthalten, in die bzw. aus der Gemeinschaft und deren Inkrafttreten am 01.01.2009, wird Katzen- und Hundefell gerne als Kaninchenfell oder auch als „fake fur“ falsch deklariert.

Das Europäische Parlament hat schon im Vorfeld der Verordnung die Problematik erkannt: Da Felle von Katzen und Hunden außerdem billiger sind als andere Pelzarten und als Ersatz für teurere Pelzarten genutzt werden können, stellt dies einen Anreiz zu unlauteren oder betrügerischen Praktiken dar; hierzu zählen falsche oder irreführende Angaben bei der Etikettierung ebenso wie andere Praktiken, die verschleiern sollen, um welche Produkte es sich eigentlich handelt und woher sie stammen. (1)

GESAMTEINFUHREN GEGERBTER PELZFELLE IN DIE EU-25-LÄNDER in Tonnen (1)

Jahr

Gesamteinfuhren

Aus China

Hauptausfuhrland

1998

3780,4

531,5

China

2005

4051,8

1295,6

China

GESAMTEINFUHREN VON BEKLEIDUNG, BEKLEIDUNGSZUBEHÖR UND SONSTIGEN WAREN gemäß KN- Code 4303 IN DIE EU-25-LÄNDER in Tonnen (1)

Jahr

Gesamteinfuhren

Aus China

Hauptausfuhrland

1998

1985,5

890,2

China

2005

3001,6

2128

China

Um das Tier zu bestimmen, von dem das Fell stammt, gibt es verschiedene Möglichkeiten: Mikroskopie, DNA-Tests und die MALDI-TOF-Massenspektrometrie. Da die Felle im Handel meist gegerbt und gefärbt sind, ist eine Isolierung von mitochondrialer DNA eine Herausforderung. Es gibt inzwischen aber viel Erfahrung mit antiker DNA und auch mit verarbeitetem Pelz. Gerade aus Italien, wo der Handel mit Pelzen schon lange strengen Verordnungen unterliegt, gibt es sehr gute Veröffentlichungen. So im Jahre 2014 von Pilli et al.: Pet fur or fake fur? A forensic approach (2).

IMG_2103

Da man zur Massenspektrometrie ein teures Gerät benötigt, habe ich mich hier auf die Mikroskopie und DNA-Tests beschränkt.

Mikroskopische Aufnahmen von Tierhaaren

IMG_0272

Kaninchenhaare

rabbit

Kaninchenhaare

 

 

 

 

 

 

cat

Katzenhaar

cat

Katzenhaar

 

 

 

 

 

 

Lara2

Hundehaar

Lara3

Hundehaar

 

 

 

 

 

 

IMG_0273

Pelzbesatz unbekannter Herkunft. (Kaninchen)

IMG_0270

Unbekannter Pelzbesatz von einem alten Schuh (Kaninchen)

 

fake 10er

Kunsthaar mit 100er Vergrößerung

rabbit 10er

Kaninchenhaar mit 100er Vergrößerung

 

 

 

 

 

 

 

 

 

 

 

 

PCR mit Tierhaaren

150323 cdr

Tierspezifische PCR
lane 1: Katze
lane 2: Hund
lane 3: Kaninchen

 

Bestimmung von tierspezifischen Abschnitten auf der mitochondrialen DNA (mtDNA).

Das amplifizierte Fragment aus mitochondrialer DNA  von Katzen ist 180 bp, von Hunden 153 bp und von Kaninchen 209 bp.

 

 

150323

lane 1: Marker
lane 2: Katzen DNA mit Katzenprimer
lane 3: Hunde DNA mit Hundeprimer
lane 4: Kaninchen DNA mit Katzenprimer
lane 5: Kaninchen DNA 1. PCR Kaninchenprimer
lane 6: Kaninchen DNA mit Hundeprimer
lane 7: Kaninchen DNA Kaninchenprimer 1. PCR
lane 8: Kaninchen DNA aus lane 7 und 2. PCR mit nested Kaninchenprimer

 

 

 

Da die Größenunterschiede in einem Agarosegel schlecht zu sehen sind, habe ich auch noch ein Polyacryamidgel gemacht.

PAC

PCR mit verschiedenen Tierhaaren
lane1: Größenmarker
lane2: Katzenhaar
lane3: Hundehaar
lane4: Katzenhaar
lane5: Haar von altem Schuh
lane6: Kaninchenhaar
lane7-9: Hundehaar

Wie gut diese Methode bei weiteren gegerbten und gefärbten Tierhaaren funktioniert, wird die Zukunft zeigen.

Untersuchung einer Kette mit angeblichem Kunstpelz

Diese Kette mit Pelzbesatz wurde als Kunstpelz verkauft.

CIMG6564

Kette mit angeblichem Kunstpelz

xy3 10

100er Vergrößerung zeigt, dass es sich um Echtpelz handelt. (Katze)

xy2

Tierhaar unbekannt (400er Vergrößerung)

xy1

Tierhaar unbekannt (Katze)

 

 

 

 

 

 

Camus

Katzenhaar aus Unterwolle (400er Vergrößerung)

rabbit2

Kaninchenhaar (400er)

rabbit1

Kaninchenhaar (400er)

fake

Kunstpelz (400er)

Mit dem Fell  wurde eine PCR mit den Katzenprimern gemacht.

PCR

PCR zeigt in lane 3 ein Produkt mit 180 bp

Das Fell sieht nicht nur unter dem Mikroskop aus wie Katzenfell, die PCR bestätigt auch DNA von Katzen an dem Fell.

 

Material und Methoden

In forensischen Analysen haben sich mitochondriale DNA Marker durchgesetzt. Mitochondriale DNA (mtDNA) ist innerhalb einer Spezies sehr gut konserviert und es gibt pro Zelle mehrere Kopien. Auch besitzen Mitochondrien noch eine zusätzliche Proteinhülle, sodass ihre DNA besser vor Degradationen geschützt ist. Innerhalb der mtDNA benutzt man heute cytrochrome b oder cytochrome c oxidase Marker (2). Deshalb wurden hier für die PCR Primer benutzt, die zwischen 150 und 300 Basenpaare (bp) der mtDNA eine definierte Spezies erkennen.

Extraktion von mitochondrialer DNA

Da in meinem Labor grundsätzlich kein Phenol oder andere giftigen Chemikalien benutzt werden, habe ich mich für verschiedene Salzfällungen entschieden.

1-2 Tierhaare wurden in 400 µl Puffer HS (10 mM Tris pH7.6, 10 mM KCl, 10 mM MgCl, 0,4 M NaCl, 2 mM EDTA), 10 µl DTT (1M), 10 µl Proteinase K und 50 µl 10% SDS über Nacht bei 55°C inkubiert. Am nächsten Morgen wurde mit 300 µl NaCl (5M) für 20 Minuten bei 12000 rpm die 1. Salzfällung durchgeführt. Aus dem Überstand wurde die DNA mit Isopropanol ausgefällt und mit 70% EtOH gewaschen. Danach wurde die DNA für 1 Stunde mit RNAse behandelt und eine 2. Salzfällung mit 300 mM Natriumacetat für 1h bei -20°C und anschließender Zentrifugation bei 12000 rpm für 20 Minuten durchgeführt. Die DNA wurde anschließend mit EtOH ausgefällt und gewaschen.

Primer für die PCR

Hund mtDNA: GAACTAGGTCAGCCCGGTACTT und CGGAGCACCAATTATTAACGGC
Produkt: 153bp
Katze mtDNA:TTCTCAGGATATACCCTTGACA und GAAAGAGCCCATTGAGGAAATC
Produkt: 180bp
Kaninchen mtDNA: AATCAAATAACAACTAAGCTGTA und TATAAAGCACCGCCAAGT 1.PCR
AATCAAATAACAACTAAGCTGTA und GCCAAGTCCTTTGAGTTTTA 2. PCR
Produkt 209bp

Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

 

(1) DAS EUROPÄISCHE PARLAMENT UND DER RAT DER EUROPÄISCHEN UNION, gestützt auf den Vertrag zur Gründung der Europäischen Gemeinschaft, insbesondere auf die Artikel 95 und 133, auf Vorschlag der Kommission, nach Stellungnahme des Europäischen Wirtschafts- und Sozialausschusses, gemäß dem Verfahren des Artikels 251 EG-Vertrag5, HABEN FOLGENDE VERORDNUNG ERLASSEN: http://ec.europa.eu/food/animal/welfare/cat_dog_fur_proposal_de.pdf

(2) Pet fur or fake fur? A forensic approach: Elena Pilli, Rosario Casamassima, Stefania Vai, Antonio Virgili, Filippo Barni, Giancarlo D’Errico, Andrea Berti, Giampietro Lago, David Caramelli. Investigative Genetics 5:7 (2014)


Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Auf Phagenjagd 7. Teil

Zuerst habe ich auf Agarplatten mit Kupfer und Sorbitol 18 verschiedene Isoloate von Erwinia amylovora isoliert und eine Gramfärbung durchgeführt.

3-18

 

Bei den Isolaten habe ich Nr. 4 und Nr. 18 ausgewählt, um Phagen zu finden.

4b

Erwinia Amylovora Isolat Nr. 4

18b

Erwinia Amylovora Isolat Nr. 18

Somit kann die Suche beginnen.

 

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

 

 

 

 

Staphylokokken

22.01.2014

Staphylokokken sind sind zwischen 0,8 und 1,2 µm grosse Bakterien. Sie sind überall auf Menschen, Tieren, Pflanzen und in Biofilmen. Sie können harmlos, nützlich, aber auch schädlich sein. Staphylokokken sind häufig resistent gegen Antibiotika, insbesondere gegen Penicilline. Staphylokokken sind grammpositiv, das heißt bei einer Färbung mit Kristallviolett und anschließender Entfärbung bleibt das dunkle Violett an der Zellmembran haften.

Staphylokokken sind auch relativ salztolerant, deshalb wachsen sie auf Agarplatten mit 7,5 % Salz. In der Gattung Staphylococcus gibt es etwa 40 Arten und eine davon ist Staphylococcus epidermidis.

Tabelle 1   Staphylococcus epidermidis
 Klasse  Bacilli
 Ordnung  Bacillales
 Familie  Staphylococcaceae
 Gattung  Staphylococcus
 Art  Staphylococcus epidermidis
 Stämme  Mindestens 24 auf gesunden Menschen (1)
 Gram-Färbung  grampositiv
 Koagulase-Reaktion  negativ, fermentiert Mannitol nicht
 Antibiotika  Novobiocin (Streptonivicin) empfindlich – MRSE
 Phagen                     Phage  82 bekannte Staphylococcus Phagen

 

S.e 1

Staphylococcus epidermidis

 

Staphylococcus epidermidis ist zwar salztolerant, kann aber Mannitol nicht fermentieren. Aus diesem Grund bleiben Platten mit Phenolrot rot – im Gegensatz zu Platten mit S. aureus.

 

 

 

Eine positive Rolle von S. epidermidis ist seine Fähigkeit den pathogenen Staphylococcus aureus zu hemmen (2).  Er ist aber auch im Verdacht eine Quelle der genetischen Vielfalt für S. aureus zu sein und mit diesem Gene auszutauschen (4).

Eine andere Gattung der Staphylokokken ist Staphylococcus aureus. 

Tabelle 2   Staphylococcus aureus
 Klasse  Bacilli
 Ordnung  Bacillales
 Familie  Staphylococcaceae
 Gattung  Staphylococcus
 Art  Staphylococcus aureus
 Stämme  2013 sind 16 Stämme bekannt die Antibiotika resistent sind (6)
 Gram-Färbung  grampositiv
 Koagulase-Reaktion  meistens positiv, fermentiert Mannitol
 Antibiotika  Novobiocin (Streptonivicin) empfindlich – MRSA
 PhagenPhage 82 bekannte Staphylococcus PhagenStaphylococcus aureus phage phiNM1Staphylococcus aureus phage phiNM2Staphylococcus aureus phage phiNM4,

Staphylococcus aureus ist auch salztolerant und kann Mannitol fermentieren. Aus diesem Grund verändert das Phenolrot durch die pH-Wert-Senkung seine Farbe nach goldgelb.

Unterscheidung von S. aureus und S. epidermidis durch pH-Wert Änderung und dadurch Umschlagen von Phenolrot auf Goldgelb.

Methicillin resistente S. aureus (MRSA) zeigen eine erhöhte Resistenz gegen Antibiotika und verursachen schätzungsweise 18.650 Todesfälle pro Jahr in den USA (5).  S. aureus ist auch das häufigste Bakterium, das bei einer Otitis gefunden wird (3). Manche S. aureus Stämme können Phagen wie Φ-PVL ( produziert Ponton Valentine Leukozidin) beherbergen, die die Virulenz erhöhen (7).

Gefährlich können Staphylokokken vor allem durch ihre Toxine werden. So können sie Lebensmittelvergiftungen (Enterotoxine), Hautentzündungen (Exfoliatine A und B), Blutvergiftungen (Panton-Valentine-Leukocidin) und auch Organversagen auslösen.

streak1

 

Streak2

Farbumschlag bei S. aureus auf Phenolrot MSA Platten

super 10

 

 

 

 

 

 

(1) A Fibrinogen-Binding Protein of Staphylococcus epidermidis. Infection and Immunity. Nilsson, Lars, Flock, Pei, Lindberg, Guss. Vol. 66, No. 6 (1998)

(2) Staphylococcus epidermidis Esp inhibits Staphylococcus aureus biofilm formation and nasal colonization. Iwase T, Uehara Y, Shinji H, Tajima A, Seo H, Takada K, Agata T, Mizunoe Y. Nature (2010)

(3) Staphylococcus epidermidis and Staphylococcus aureus in otitis media with effusion. Kurono Y, Tomonaga K, Mogi G. Arch Otolaryngol Head Neck Surg (1988)

(4) Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Diep BA, Gill SR, Chang RF, Phan TH, Chen JH, Davidson MG, Lin F, Lin J, Carleton HA, Mongodin EF, Sensabaugh GF, Perdreau-Remington F. Lancet (2006)

(5) Invasive methicillin-resistant Staphylococcus aureus infections in the United States.Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K, Ray S, Harrison LH, Lynfield R, Dumyati G, Townes JM, Craig AS, Zell ER, Fosheim GE, McDougal LK, Carey RB, Fridkin SK. JAMA (2007)

(6) NARSA net http://www.narsa.net/control/member/allapprovedisolates

(7) Panton-valentine leukocidin genes in a phage-like particle isolated from mitomycin C-treated Staphylococcus aureus V8 (ATCC 49775). Kaneko J, Kimura T, Kawakami Y, Tomita T, Kamio Y. Biosci Biotechnol Biochem. 1997 Nov;61(11):1960-2.

(8) Characterization and genomic analysis of two Staphylococcus aureus bacteriophages isolated from poultry/livestock farms. Yoon H, Yun J, Lim JA, Roh E, Jung KS, Chang Y, Ryu S, Heu S. J Gen Virol. (2013)

 

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.