Category Archives: Natur

Helix pomatia

Weinbergschnecke

Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Voucher 09
Voucher 09




.

.

.

.

.

.

.

.

.

.

>Helix pomatia|09|42AF10
TATAGTTATTTCTGCTCATGACTTAAATAGCCGCAGTACTCTGACTGTGCAAAGGTAGCATAATCAGTTGGCTTTTAATTAGAGTCTGGTATGAACGAAAATATGGGTAGTAACTGTCTTAGCACATTTTTTCGAACTTATTAAACAAGTGCAAATGCTTGTAATTTAACAATAGACGAGAAGACCCTAGAAACTTGGACAAGTTTTTGTTGGGGCGACAGAATTACACTTAACTAATCTTATAATACACGACGCGATGTTGAAAGAATAAGTTACTCTAGGGATAACAGCATAATTTCATTAGTTTGTGACCTCGATGTTGGACTAGGTACTATACCCTTAAGGCAAGGATATATTATGCTCTGTTCGAGCAAAATTACCTACATGATCTGAGTTCAGACCGGAGTCCT

.

.

Voucher 10

.

ö


.öö

ö

ö

ö

ö

ö

ö

ö

öö

ü

ü

ü

>Helix pomatia|10|42AF15
ATAGTTATTTCTGCTCATGACTTAAATAGCCGCAGTACTCTGACTGTGCAAAGGTAGCATAATCAGTTGGCTTTTAATTAGAGTCTGGTATGAACGAAAATATGGGTAGTAACTGTCTTAGCACATTTTTTCGAACTTATTAAACAAGTGCAAATGCTTGTAATTTAACAATAGACGAGAAGACCCTAGAAACTTGGACAAGTTTTTGTTGGGGCGACAGAATTACACTTAACTAATCTTATAATACACGACGCGATGTTGAAAGAATAAGTTACTCTAGGGATAACAGCATAATTTCATTAGTTTGTGACCTCGATGTTGGACTAGGTACTATACCCTTAAGGCAAGGATATATTATGCTCTGTTCGAGCAAAATTACCTACATGATTGAGTTCAGACCGG

ö

ö

Chromatogramm von Voucher 10

ö

ö

ö

üppp

ü

ü

ü

ü

ä

FFFFFF

äüüü

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.

p

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Zerstörungen durch den FF Forst

08.05.2019

Da im Forst bei Bräunlingen, mit dem Namen Habseck, schon seit geraumer Zeit massiv die Natur zerstört wird und die Verstöße leider keinen interessieren, will ich hier eine Dokumentation über die Zerstörung des Waldes, des Bodens, der Flora und Fauna auf der Gemarkung Mistelbrunn durch den Fürstenberg Forst machen.

Schon im Jahr 2016 fiel mir auf, dass auf den Flurstücken 64 Gemarkung Mistelbrunn, Tümpel mit Kaulquappen zugeschüttet wurden. Dies geschah im Frühjahr – also Mai 2016 – ; ich wollte nach den Kaulquappen dort sehen und fand nur noch zugeschüttete Gräben. Leider habe ich damals weder die Kaulquappen noch die Zerstörungen dokumentiert.

Als an Ostern 2019 Öl in einen Bach floss dachte ich das zu ändern.

Hier Aufnahmen vom 19. April 2019:

Mit diesen Fotos ging ich gleich am 20.04.2019 zur Polizei Donaueschingen, damit das Öl nicht weiter in den Bach fließt.

Die Polizei ließ dies durch den Forst untersuchen und die Feuerwehr hat einen Schnelltest auf Schweröl gemacht, der negativ war. Weiter vermeldete die Polizei: „Unabhängig davon wurde in Erfahrung gebracht, dass die Forstgeräte (in diesem Fall wäre es ein Vollernter gewesen) im professionellen Bereich ausschließlich Bio-Hydrauliköl und Bio-Sägekettenöl betrieben werden dürfen. Diese Öle sind biologisch abbaubar. Zudem gilt ein gewisser Verlust während der Arbeiten als normal.“

Das Naturschutzamt vermeldete:

„…Ihre Meldung geprüft wurde, können wir Ihnen bestätigen, dass  die Gewässerverunreinigung nicht durch Öl, sondern durch Huminstoffe verursacht wurde, die infolge eines forstlichen Einsatzes freigesetzt wurden.“

Also flossen Huminstoffe in den Bach. Den Bachlauf hatte ich am 19.04.2019 allerdings fotografiert, da dort Bergmolche (Ichthyosaura alpestris), Laich und Kaulquappen vorhanden waren.

Am 05.05.2019 war dieser Bachlauf zerstört.

Da ich beim Naturschutzamt schon Ostern eine Meldung gemacht hatte und darauf nicht eingegangen wurde. Habe ich am 08.05. eine etwas präzisere Meldung gemacht.

Bezugnehmend auf die § 14 (2), § 5 (2), § 5 (3), § 44 (1) des Bundesnaturschutzgesetzes (BNatSchG) sowie § 17 des Tierschutzgesetz (TierSchG) und § 11 des Bundeswaldgesetz (BWaldG) meldete ich den Fürstlich Fürstenbergischen Forst (FF Forst). Die zur Anzeige kommenden Handlungen wurden auf dem Flurstück 64, Gemarkung 6172 Mistelbrunn, durchgeführt.

Die hügelbauenden Waldameisen gehören in Deutschland nach der Bundesartenschutzverordnung (BArtSchV) zu den besonders geschützten Tierarten. Dieser allgemeine Schutz ergibt sich aus § 44 (BNatSchG). Demnach dürfen sie nicht der Natur entnommen oder gar getötet werden. Jeder Eingriff in die Neststruktur ist strengstens untersagt. Auf den oben genannten Flurstücken wurden mehrere Ameisenhügel zerstört. Zum Teil sogar neben der bearbeiteten Forstfläche. Die Fläche wurde ohne ersichtlichen Grund mit Geräten mittig überfahren.

Der Bach in den an Ostern Baumöle abflossen, habe ich am 19. April 2019 dokumentiert. Es befanden sich dort Bergmolche, Laich und Kaulquappen unbekannter Art. Dieser Bachlauf wurde von schweren Erntemaschinen zerstört, indem längs durchgefahren wurde. Deshalb erstatte ich Anzeige wegen Verstoß gegen § 17 TierSchG da Wirbeltiere ohne vernünftigen Grund getötet wurden. Sowie wegen Verstoß gegen § 44 (1) (BNatSchG) da wild lebende Tiere getötet wurden und ihr Habitat zerstört wurde. Dass der Forst dort Habitate zuschüttet ist in den letzten Jahren wiederholt zu beobachten gewesen.

Laubbäume werden wie Unkraut gefällt und liegen gelassen. Das Waldbiotop Bruderbächle wird mit Ernteabfällen und Unrat voll gekippt. Auf den verdichteten Böden werden breitflächig Schichten von Fichtenabfall liegen gelassen. Dies widerspricht nicht nur § 11 des Bundeswaldgesetz (BWaldG), sondern die unsachgemäße Forstwirtschaft gefährdet unmittelbar die Ortschaften Hubertshofen, Mistelbrunn, sowie Unterbränd durch Waldbrände.

Bruderbächle
Bruderbächle

Es wurden keine Ziele des Naturschutzes und der Landschaftspflege berücksichtigt, deshalb ist die forstliche Bodennutzung dort als Eingriff anzusehen § 14 (2) (BNatSchG).

Nach § 5 (2) (BNatSchG) sollen folgenden Grundsätze der guten fachlichen Praxis beachtet werden:

1. die Bewirtschaftung muss standortangepasst erfolgen und die nachhaltige Bodenfruchtbarkeit und langfristige Nutzbarkeit der Flächen muss gewährleistet werden;

2. die natürliche Ausstattung der Nutzfläche (Boden, Wasser, Flora, Fauna) darf nicht über das zur Erzielung eines nachhaltigen Ertrages erforderliche Maß hinaus beeinträchtigt werden;

Nach § 11 BWaldG soll der Wald im Rahmen seiner Zweckbestimmung ordnungsgemäß und nachhaltig bewirtschaftet werden. Dies ist im Forst auf der Gemarkung Mistelbrunn nicht ansatzweise zu erkennen.

update 13.05.2019

Mountaintop removal

In Kentucky gibt es ein „mountaintop removal“. Damit ist gemeint, wenn man die Bergspitze wegsprengt um an die Kohle zu gelangen. Es erinnert mich stark an das was im FF Forst mit den Ameisenhügeln geschieht: Ein mountaintop removal. So zumindest sehen die noch lebenden Ameisenhügel aus. Hier eine relativ frischer „mountaintop removal“ vom 11. und 12. Mai 2019.

Ameisenhügel mit entfernter Spitze

..

und so sieht das ganze von oben aus

Es gibt im FF Forst aber nicht nur das mountaintop removal, sondern auch einige überfahrene und tote Haufen:

Daneben wird achtlos Holz und Ernteabfälle drauf geworfen:

Mysteriöser Tod nach mountaintop removal

Abschleifen der Bäche mit Molchen, Laich und Kaulquappen im Mai

Es werden nicht nur Waldameisen vernichtet, sondern auch andere Habitate sind einfach im Weg und werden kurzerhand zerstört.

Begehung mit dem Förster Tröndle vom FF Forst und Dr. Hans-Peter Straub vom Baurechts- und Naturschutzamt am 14. Mai 2019

Bei der Begehung hat sich herausgestellt, dass das Naturschutzamt § 44 BNatSchG für nicht sonderlich wichtig erachtet und dem Forst da einen Spielraum gewährt. Zur Erinnerung:

Die hügelbauenden Waldameisen gehören in Deutschland nach der Bundesartenschutzverordnung (BArtSchV) zu den besonders geschützten Tierarten. Dieser allgemeine Schutz ergibt sich aus § 44 (BNatSchG). Demnach dürfen sie nicht der Natur entnommen oder gar getötet werden. Jeder Eingriff in die Neststruktur ist strengstens untersagt.

Auf den oben genannten Flurstücken wurden mehrere Ameisenhügel überfahren oder Holz darauf abgelegt. Dr. Straub findet dies nicht sonderlich schlimm und Teil des forstwirschaftlichen Arbeitens.

Da in den Gräben noch lebende Molche gefunden wurden, ist auch dies nicht sonderlich schlimm.

Das „Mountaintop removal“ seien die randalierenden Kinder gewesen, die sich nur im FF Forst aufhalten. Laut Herr Dr. Straub weiß jeder der Söhne hat, dass die zu so etwas in der Lage wären. Vielleicht sollte man mal ein ernstes Wort mit der Mistelbrunner Landjugend wechseln?

Meine Umweltmeldung wurde also vom Naturschutz abgearbeitet und der Förster Tröndle wurde vom Amt für seine hervorragende Arbeit gelobt.

Dass man mir keine Rechnung vorgelegt hat, ist nur der deutlichen Gesetzeslage zu verdanken.

Ich werde dieses Kapitel auch erst mal schließen und den Forst weiter beobachten und hoffen, dass nun sorgfältiger gearbeitet wird.

Falls weiterhin Ameisenhügel zerstört werden, gibt es die Möglichkeit einer Strafanzeige.

.

.

.

.

Zitierte Gesetze vom Stand Mai 2019

Bundesnaturschutzgesetz

§ 14 (2) (BNatSchG)

Die land-, forst- und fischereiwirtschaftliche Bodennutzung ist nicht als Eingriff anzusehen, soweit dabei die Ziele des Naturschutzes und der Landschaftspflege berücksichtigt werden.

§ 5 (2) (BNatSchG)

Bei der landwirtschaftlichen Nutzung sind neben den Anforderungen, die sich aus den für die Landwirtschaft geltenden Vorschriften und aus § 17 Absatz 2 des Bundes-Bodenschutzgesetzes ergeben, insbesondere die folgenden Grundsätze der guten fachlichen Praxis zu beachten:

1.die Bewirtschaftung muss standortangepasst erfolgen und die nachhaltige Bodenfruchtbarkeit und langfristige Nutzbarkeit der Flächen muss gewährleistet werden;

2.die natürliche Ausstattung der Nutzfläche (Boden, Wasser, Flora, Fauna) darf nicht über das zur Erzielung eines nachhaltigen Ertrages erforderliche Maß hinaus beeinträchtigt werden;

§ 5 (3) (BNatSchG)
Bei der forstlichen Nutzung des Waldes ist das Ziel zu verfolgen, naturnahe Wälder aufzubauen und diese ohne Kahlschläge nachhaltig zu bewirtschaften. 2 Ein hinreichender Anteil standortheimischer Forstpflanzen ist einzuhalten.


§ 44 (1) (BNatSchG)
Es ist verboten,1. wild lebenden Tieren der besonders geschützten Arten nachzustellen, sie zu fangen, zu verletzen oder zu töten oder ihre Entwicklungsformen aus der Natur zu entnehmen, zu beschädigen oder zu zerstören,

2. wild lebende Tiere der streng geschützten Arten und der europäischen Vogelarten während der Fortpflanzungs-, Aufzucht-, Mauser-, Überwinterungs- und Wanderungszeiten erheblich zu stören; eine erhebliche Störung liegt vor, wenn sich durch die Störung der Erhaltungszustand der lokalen Population einer Art verschlechtert,

3. Fortpflanzungs- oder Ruhestätten der wild lebenden Tiere der besonders geschützten Arten aus der Natur zu entnehmen, zu beschädigen oder zu zerstören,

Tierschutzgesetz

§ 17 TierSchG

Mit Freiheitsstrafe bis zu drei Jahren oder mit Geldstrafe wird bestraft, wer

1. ein Wirbeltier ohne vernünftigen Grund tötet oder

2.einem Wirbeltier

a)aus Rohheit erhebliche Schmerzen oder Leiden oder

b)länger anhaltende oder sich wiederholende erhebliche Schmerzen oder Leiden zufügt.

Bundeswaldgesetz

§ 11 BWaldG

Bewirtschaftung des Waldes

(1) Der Wald soll im Rahmen seiner Zweckbestimmung ordnungsgemäß und nachhaltig bewirtschaftet werden. Durch Landesgesetz ist mindestens die Verpflichtung für alle Waldbesitzer zu regeln, kahlgeschlagene Waldflächen oder verlichtete Waldbestände in angemessener Frist

1.wieder aufzuforsten oder

2.zu ergänzen, soweit die natürliche Wiederbestockung unvollständig bleibt,

falls nicht die Umwandlung in eine andere Nutzungsart genehmigt worden oder sonst zulässig ist.

(2) Bei der Bewirtschaftung sollen

1.die Funktion des Waldes als Archiv der Natur- und Kulturgeschichte sowie

2.im Falle von Parkanlagen, Gartenanlagen und Friedhofsanlagen die denkmalpflegerischen Belange angemessen berücksichtigt werden.

.

.

.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Arion vulgaris

Spanische Wegschnecke







Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Arion_vulgaris|05|42AF12
TCTCTCTATTAGGTAAGTCTGCCCGGTGATTTTTTTTAACGGCCGCAGTACTTTGACTGTGCTAAGGTAGCAAAATAAATAGGCTTATAATTAAGGTCGGGTATGAATGAACTAATGGGAGGAAGCTGTCTCTTTTGATTAGAACTACATTATTTTATAGGTGATTTCGCTTAGAGAGCGTATATACACAAGTGTACCTTAGAAACTTGTTATTCTTTTTGTGGGGGGGGAGAATTGCGGTTAATATGCCCGTGGCTATTTGACCTTAACTGATTAT

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Cepaea nemoralis

Hain Schnirkelschnecke

Wie die 16S rDNA sequenziert wurde bitte hier schauen.


Voucher 07
Voucher 07


.

.

.

Voucher 07

.


>07|Cepaea nemoralis|42AF11
TTCTGCTCCATGGTATGCTAAATAGCCGCAGTACTCTGACTGTGCAAAGGTAGCATAATAATTTGGCTTATAATTGAAGTCTGGTATGAAAGAACTAATGGGAGGTAGCTGTCTCCAGGGTATTAGTACTAAATTAGTAAGTAAGTGAAAATACTTACAGAGAGAAAATAGACGAGAAGACCCTAGAAGCTTGCTATTTGTTTTGTTGGGGCGACAGAATTGCATTTAAACCAATTTTATAGATGTGACGTAGAGCAGGAAAATTAAGCTACTCTAGGGATAACAGCATAATAAAATTTGTTTGTGACCTCGATGTTGGACTAGGTAGAATAGTCCTTAGAAGGGACTAAAAATGCTCTGTTCGAGCAGATTAACCTACATGATCTGAGTTCAGACCGG

Voucher 03

>03|Cepaea nemoralis|42AF08
TTCTGCTCCATGGTATGCTAAATAGCCGCAGTACTCTGACTGTGCAAAGGTAGCATAATAATTTGGCTTATAATTGAAGTCTGGTATGAAAGAACTAATGGGAGGTAGCTGTCTCCAGGGTATTAGTACTAAATTAGTAAGTAAGTGAAAATACTTACAGAGAGAAAATAGACGAGAAGACCCTAGAAGCTTGCTATTTGTTTTGTTGGGGCGACAGAATTGCATTTAAACCAATTTTATAGATGTGACGTAGAGCAGGAAAATTAAGCTACTCTAGGGATAACAGCATAATAAAATTTGTTTGTGACCTCGATGTTGGACTAGGTAGAATAGTCCTTAGAAGGGACTAAAAATGCTCTGTTCGAGCAGATTAACCTACATGATCTGAGTTCAGACCGG

.

.

.

.

.

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


DNA Extraktion und 16S PCR Schnecken

22.02.2019

Malakazoologen sind diejenigen, die Schnecken bestimmen und untersuchen. Leider sind diese Zoologen bis heute eher Schnecken Leichenfledderer und „Häuslesammler“. Jetzt wollte ich aber unsere einheimischen Schnecken bestimmen und fotografieren, ohne diese irgendwie zu stören.
So kam mir die Idee, nach meinen umfassenden Untersuchungen mit dem Alpenveilchen, bei den Schnecken ebenso mit der DNA zu arbeiten.

Durch Recherche fand ich, dass es eine umfassende Datenbank auf NCBI gibt über das 16S als Marker für verschiedene Schnecken (1).

In meinem Labor benutze ich grundsätzlich keine giftigen Chemikalien wie Phenol, Mecaptoethanol oder Chloroform, die man normaler Weise zum Aufreinigen von DNA verwendet. Deshalb habe ich ein Protokoll entwickelt, das für Schnecken funktioniert ohne diese auf irgend eine Weise zu verletzten oder diese Chemikalien zu verwenden.

Ich habe ziemlich viel Zeit in dieses Protokoll investiert und will es hier gerne mit interessierten Menschen teilen.

Extraktion von DNA aus Schnecken ohne Phenol

Schnecke auf Swab

Ausgangsmaterial ist ein Abstrich mit einem Wattestab (Swab).

Hierbei wird sich die Schnecke zurück ziehen, das macht aber nichts.

Dann kommt der Kopf vom Swab in ein Eppi.

Je Eppi nehme ich 800 µl HS Buffer, plus 100 µl SDS (10%), plus 20 µl DTT, plus 40  µl Proteinase K und plus 20 µl RNAse.

HS Buffer

10 mM TrisHCl pH 7.6
10 mM KCl
10 mM MgCl2
400 mM NaCL
2 mM EDTA

Proteinase K

20 mg/ml in 100mM Tris pH 8,6, 6 mM CaCl2, 50% Glycerin. Lagern bei -20°C

DTT

5 g DTT in 32,4 ml H2O oder 1M. Bei  20°C lagern.

Das ganze wird vorsichtig gemischt und kommt bei 50°- 55°C für vier Stunden in den Heizblock. Ab- und an das Eppi bisschen bewegen.

Dann kommt das Eppi für 3 Minuten in die Zentrifuge mit Vollspeed. 700 µl vom Überstand kommen  mit 600 µl Isopropanol in ein neues Eppi und werden vorsichtig gemischt. Das alles bei Raumtemperatur! Dann wird die DNA 5 Minuten bei 12 K rpm abzentrifugiert. Nicht zu lange oder zu kalt, sonst kommt unerwünschtes irgendwas mit.

Danach kann man das Pellet 2 x mit 70% EtOH waschen, trocknen und in 20 µl TE oder H2O auflösen.

Falls die PCR später nicht funktioniert, kann das am ehesten an der DNA liegen. Natürlich nur, wenn man sich mit den Primern sicher ist. Hier empfiehlt sich eine positiv Kontrolle. Probleme mit der DNA kommt oft von der Proteinase K. Meiner Erfahrung nach kann man da mit der Konzentration und der Verdauzeit eher hoch gehen, als runter.  Wichtig ist auch ein guter RNA Verdau. RNA kann auch die PCR stören.


PCR der 16S mitochondrialen rDNA von Schnecken

16S Produkt ist etwa 400 bp groß

Die Primer sind alt bekannt und wurden 1991 von Palumbi veröffentlicht (2). Ich habe sie allerdings etwas modifiziert:

HM103f – CGCCTGTTTATCAAAAACAT
HM104r – CCGGTCTGAACTCAGAT

PCR: 30 cycles mit annealing 54°C und Phusion Taq (NEB)

Die Bande wird ausgeschnitten, mit dem Monarch DNA kit von New England Labs aufgereinigt, bei GATC in Köln mit Primer HM103 sequenziert und die Sequenz mit NCBI Blast abgeglichen.

Hier das Ergebnis mit meinem ersten Versuch, der oben abgebildeten Posthornschnecke.


(1) Razkin et al., Molecular phylogeny of the western Palaearctic Helicoidea (Gastropoda, Stylommatophora). Molecular Phylogenetics and Evolution, Volume 83, Pages 99-117 (2015)

(2) Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., The Simple Fool’s Guide to PCR, Version 2.0. Department of Zoology, University of Hawaii, Honolulu, HI. (1991)

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


Alpenveilchen Teil 5.

März 2018

Cyclamen purpurascens am Walensee im Kanton St. Gallen.

 

 

 

 

 

Die Anfänge stehen im Teil 1.-4

Die ribosomale DNA (rDNA) als geographischer Marker bei Cyclamen purpurascens hat sich inzwischen bewährt. Nochmal kurz zur rDNA:

Die rDNA kodiert die Gene für ribosomale RNA, also einen Großteil der Ribosomen. In eukaryotischen Zellen gibt es rDNA nicht nur im Zellkern, sondern auch in den Mitochondrien, und bei Pflanzen zusätzlich in den Plastiden. Dazu kommt, dass es ein Repeat ist, sich also ziemlich oft wiederholt. Dies alles verursacht bei der Sequenzierung Probleme, auf die ich hier nicht näher eingehen will.

Gerade die Spacer zwischen den einzelnen Transkriptionseinheiten sind für die Unterscheidung sehr interessant. Dies sind ETS, ITS1und ITS2

rDNA-Repeat der ribosomalen Untereinheiten. Der external transcribed spacer (ETS) und die internal transcribed spacer (ITS1 + ITS2) befinden sich zwischen den Transkriptionseinheiten.

Vor allem mit Hilfe des Forum Flora Austria konnte ich viele verschiedene Blätter von Cyclamen purpurascens aus Österreich bekommen. An dieser Stelle nochmals vielen Dank an alle Beteiligten! Ihr habt mich einen großen Schritt weiter gebracht.

Die roten Punkte nummerieren die untersuchten Blätter von Cyclamen purpurascens.

Sequenzanalyse

Die Extraktion der gDNA habe ich hier beschrieben und das Sequenzieren hier.

Man kann zwei Sequenzfiles namens AB1 mit einem Programm namens SeqDoc vergleichen. Oben und unten sind die verschiedenen Sequenzen und in der Mitte die Gemeinsamkeiten (flacher Peak) und Unterschiede (großer Peak).

Ein  Unterschied zwischen den Pflanzen aus Österreich und der Schweiz liegt vorne auf dem ETS. So ist nach den GGG bei den Pflanzen aus der Schweiz und Italien nur ein C, bei den Österreichischen Pflanzen zwei CC vor den vier AAAA.  Hier die Peaks:

Vergleich von 50 Basen auf dem ETS zwischen einer Pflanze aus dem Tessin und einer aus Niederösterreich.

Ein anderer auffälliger Unterschied ist im ITS1. Hier ist ebenfalls bei den Österreichischen Pflanzen eine Base (G) mehr.

Chromatogramm mit zwei AB1 files von der Sequenzierung mit SeqDoc.

Am Anfang vom ETS kann man schon die verschiedenen Standorte unterscheiden. Die rDNA Sequenzen der verschiedenen Standorte wurde mit dem Programm Multi Sequence Alignment by CLUSTALW verglichen. Hier die Sequenz vom ETS vorne mit ausgewählten Pflanzen:

5′ Ende vom ETS mit 50 Basen von ausgewählten Standorten.

Mit dem dem Programm Multi Sequence Alignment by CLUSTALW kann man einen polygenetischen Baum mit den Sequenzen der rDNA erstellen.

Polygenetischer Baum mit den Sequenzen der rDNA.

Klostergärten der Benediktiner

Kommen wir zu dem Rätsel, warum die Pflanzen aus dem Klostergarten Allerheiligen in Schaffhausen, die Pflanze aus Orljavac in Kroatien und die Tuttlinger Pflanze aus der Nähe vom Kraftstein die selbe Sequenz wie die Pflanzen aus Österreich haben.

Die Pflanze aus Kroatien stammt aus der Nähe der Benediktiner Abtei des heiligen Mihovil.

Benediktiner-Abtei des Heiligen Michael bei Orljavac.

Das Kloster Allerheiligen wurde ebenso von den Benediktinern gegründet und bei Tuttlingen befindet sich das Kloster Beuron mit der Erzabtei St. Martin.

Die Benediktiner legten schon früh Heilpflanzengärten an und brachten viele Pflanzen über die Alpen. Damals war es auch üblich, dass einmal im Jahr Bauern eingeladen wurden, um in den Gärten unterrichtet zu werden. Dieser Brauch war noch bis 1911 im Salzburgischen Kloster üblich. Salzburg war und ist mit der Erzabtei St. Peter ein Zentrum der Benediktiner. „Wolfgang Erdäpferl“ wurden Cylamen purpurascens von den Einheimischen genannt und  es wurde ihm eine besonders heilende Wirkung bei Schlangenbiß, Migräne, Kopfbeschwerden und als Zaubertrank nachgesagt. (Siehe Salzburgwiki). 

Von wo aus genau -Salzburg oder Wien- die Benediktiner das Alpenveilchen ursprünglich verteilt haben, lässt sich nicht genau sagen. Es gibt sowohl im Salzburger Land, als auch in Niederösterreich Cyclamen mit der selben Sequenz der rDNA. Allerdings sind die Pflanzen um Wien einheitlich und die Pflanzen um Salzburg weisen zum Teil erhebliche Variationen auf. Es läßt sich also spekulieren, dass um Salzburg das „Erdapferl“, das im großen Stiel als Heil- und Fruchtbarkeits- Symbol für Pilger gesammelt und verkauft wurde, dadurch vielleicht etwas selten wurde. Womöglich wurde um Salzburg denn wieder mit Pflanzen aus den Klostergärten „aufgeforstet“.

Klostergarten Allerheiligen in Schaffhausen.

Cyclamen purpurascens war für die Benediktiner eine wichtige Heilpflanze die in den Klostergärten zu finden war und ist. Allem Anschein nach wurde das Alpenveilchen von den Benediktinern aus Österreich über die Ränder der Alpen hin verteilt. Wenn die Bedingungen für die Pflanzen gut waren, kann man sie heute noch finden.

Allerdings stammt das Cyclamen purpurasecens im Brigachtal nicht aus Österreich.

Woher es stammt, wird die Zukunft zeigen. Es fehlen mir noch einige natürliche Standorte.

 

 

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

 

 

Irreguläre Tierversuche in Erlangen

März 2018 aktualisiert am 14. April 2019

Die Friedrich-Alexander-Universität Erlangen-Nürnberg publizierte in den letzten Jahren eine Reihe nicht schlüssiger Veröffentlichungen, auf die ich hier näher eingehen will.

Tierversuche müssen nach §8 Tierschutzgesetz von der zuständigen Behörde (hier Regierung von Unterfranken) genehmigt werden. Die Behörde vergibt dazu eine Nummer. Mir ist aufgefallen, dass unter ein und derselben Genehmigungsnummer mehrere Tierversuche an verschiedenen Tierarten (Beagle und Schweine) publiziert wurden und dass für ein und denselben Versuch unterschiedliche Genehmigungsbehörden (Franken und Ungarn) angegeben werden.

In folgender Liste sind die widersprüchlichen Angaben aus den einzelnen Veröffentlichungen zusammengefasst:

Genehmigungsnummer
Jahr
Titel
DOI Genehmigungsbehörde   Autoren   verbrauchte Tiere
54-2532.1-45/12

2017

The influence of different abutment materials on tissue regeneration after surgical treatment of peri-implantitis – a randomized controlled preclinical study.

10.1016/j.jcms.2017.05.025

„Pest county government department for food safety and animal health“


Ungarn

 Tobias Moest, Jan Wrede, Christian Martin Schmitt, Melanie Stamp, Friedrich Wilhelm Neukam, Karl Andreas Schlegel   8 Beagle
54-2532.1-45/12

2016

Soft tissue volume alterations after connective tissue grafting at teeth: the subepithelial autologous connective tissue graft versus a porcine collagen matrix – a pre-clinical volumetric analysis

10.1111/jcpe.12547

„Pest county government department for food safety and animal health“


Ungarn

Christian Martin Schmitt, Regai E. Matta, Tobias Moest, Julia Humann, Lisa Gammel, Friedrich Wilhelm Neukam, Karl Andreas Schlegel   8 Beagle
54-2532.1-45/12

2014

Bone formation in peri-implant defects grafted with microparticles: a pilot animal experimental study.

10.1111/jcpe.12295

„a state Animal Research Committee in Bavaria“

Ansbach

Tobias Moest, Franz Koehler, Christopher Prechtl, Christian Martin Schmitt, Georg Watzek, Karl Andreas Schlegel   6 Schweine
22.1/121/3/2011

2017

Periosteal elevation induces supracortical peri-implant bone formation.

10.1111/jcpe.12547

„Pest county government department for food safety and animal health“


Ungarn

Rainer Lutz, Christina Sendlbeck, Hommeira Wahabzada, Christian Tudor, Christopher Prechtl, Karl Andreas Schlegel   24 Schweine
22.1/121/3/2011

2015

In vivo evaluation of biofunctionalized implant surfaces with a synthetic peptide (P-15) and its impact on osseointegration. A preclinical animal study.

10.1111/clr.12723

„Pest county government department for food safety and animal health“


Ungarn

Christian M. Schmitt, Markus Koepple, Tobias Moest, Konrad Neumann, Tamara Weisel, Karl Andreas Schlegel    10 Beagle
22.1/121/3/2011

2016

Search for a reliable model for bisphosphonate-related osteonecrosis of the jaw: establishment of a model in pigs and description of its histomorphometric characteristics.

10.1016/j.bjoms.2016.05.025

„under license“


keine Angabe

Konstantinos T. Mitsimponas, Tobias Moest, Christos Iliopoulos, Thomas Rueger, Cornelia Katharina Mueller, Rainer Lutz, K. Shakib, Friedrich Wilhelm Neukam, Karl Andreas Schlegel    12 Schweine
22.1/121/3/2011

2015

Establishment of a new pull-out strength testing method to quantify early osseointegrationdAn experimental pilot study.

10.1016/j.jcms.2015.10.005

„the Animal Research Committee“


keine Angabe

J. Nonhoff, Tobias Moest, Christian Martin Schmitt, T. Weisel, S. Bauer, Karl Andreas Schlegel    6 Schweine
54-2531-25/07

2011

Tierexperimentelle Studie zur Knocheneinheilung chemisch oberflächenmodifizierter Implantate im Typ- 2 diabetischen Schwein

Dissertation

„Tierversuchskommission der Regierung von Mittelfranken“


Ansbach

Tobias Moest   15 Schweine
54-2531-25/07

2016

Peri-implant defect regeneration in the diabetic pig:
A preclinical study

10.1016/j.jcms.2016.04.002

„Committee for Animal Research, Franconia“


Franken

Cornelius von Wilmowsky, Karl Andreas Schlegel, Christoph Baran, Emeka Nkenke, Friedrich Wilhelm Neukam, Tobias Moest   6 Schweine
54-2531-25/07

2011

Diabetes mellitus negatively affects peri-implant bone formation in the diabetic domestic pig.

10.1111/j.1600-051X.2011.01746.x

„Committee for Animal Research, Government
of Midfranconia“


Ansbach

Cornelius von Wilmowsky, Philipp Stockmann, Igor Harsch, Kerstin Amann, Philipp Metzler, Rainer Lutz, Tobias Moest, Friedrich Wilhelm Neukam, Karl Andreas Schlegel   25 Schweine
54-2531.31-25/07

2011

PEG matrix enables cell-mediated local BMP-2 gene delivery and increased bone formation in a porcine critical size defect model of craniofacial bone regeneration

10.1111/j.1600-0501.2011.02223.x

„Committee for animal research of the government of Middle Franconia“


Ansbach

Falk Wehrhan, Kerstin Amann, Aart Molenberg, Rainer Lutz, Friedrich Wilhelm Neukam, Karl Andreas Schlegel   15 Schweine
54-2531.31-25/07

2012

Critical size defect regeneration using PEG-mediated BMP-2 gene delivery and the use of cell occlusive barrier membranes – the osteopromotive principle revisited.

10.1111/j.1600-0501.2012.02489.x

„Committee for animal research of the government of Middle Franconia“


Ansbach

Falk Wehrhan, Kerstin Amann, Aart Molenberg, Rainer Lutz, Friedrich Wilhelm Neukam, Karl A. Schlegel   20 Schweine
621.2531.31-06/02

2011

Comparative analysis of osseointegration of titanium implants with acid-etched surfaces and different biomolecular coatings

10.1016/j.tripleo.2011.01.004

„government of Midfrankonia“


Ansbach

Cornelia Katharina Mueller, Michael Thorwarth, Michelle Schmidt, Karl Andreas Schlegel, Stefan Schultze-Mosgau   9 Schweine
621.2531.31-10/98

2009

Influence of residual alveolar bone height on osseointegration of implants in the maxilla: a pilot study

10.1111/j.1600-0501.2008.01598.x

„Regional
Government of Mittelfranken“


Ansbach

Matthias Fenner, Eleftherios Vairaktaris, Kathrin Fischer, Karl Andreas Schlegel, Friedrich Wilhelm Neukam, Emeka Nkenke   8 Schweine
22.1/3879/003/2008

2015

Extra-oral defect augmentation using autologous, bovine and equine bone blocks: A preclinical histomorphometrical comparative study.

10.1016/j.jcms.2015.02.012

„a state Animal
Research Committee „


keine Angabe

Tobias Moest, Falk Wehrhan, Rainer Lutz, Christian Martin Schmitt, Friedrich Wilhelm Neukam, Karl Andres Schlegel   20 Schweine

Was sagt uns nun diese lange Liste, ausser dass sie für mich sehr viel Arbeit war?

Unter der Genehmigungsnummer 54-2532.1-45/12 finden wir verschiedene Experimente bei denen zum einem Teil Schweinen Implantate in den Kopf geschraubt werden und bei anderen Experimenten bei Hunden Implantate im Kiefer getestet werden. Bei den getöteten Hunden steht, dass diese Genehmigungsnummer von einem „Pest county government department for food safety and animal health“ in Ungarn vergeben wurde. Weiter unten bei der Studie von 2017 steht jedoch, dass die Studie an der Friedrich-Alexander Universität, Erlangen-Nürnberg durchgeführt wurde. Also vergibt Ungarn Genehmigungsnummern für Experimente an Hunden in Erlangen? Vergibt Ungarn hierfür die selbe Nummern wie Ansbach für Experimente mit Schweinen?

Des weiteren gibt es unter der Nummer 22.1/121/3/2011 verschiedene Studien mit insgesamt 42 Schweinen und 10 Beagle, die alle an der Universität Erlangen durchgeführt wurden. Oder doch nicht? Zum Teil wird das Amt in Ungarn erwähnt, zum Teil nur ein „comittee“ oder „license“, einmal als Lieferant der Schweine (2015) die Renner GmbH, die, soweit ich informiert bin, nur in Deutschland Tiere liefert. Also doch Erlangen?

Da in den Veröffentlichungen um Professor Schlegel keine Kooperation mit Ungarn oder anderen Universitäten auszumachen ist, gehe ich davon aus, dass alle Versuche an der Universität Erlangen durchgeführt wurden. Dies wird auch zum Teil extra erwähnt. Soviel ich in Erfahrung bringen konnte, ist es nach dem ungarischen Tierschutzgesetz von 2013 verboten, Beagle in 6 Quadratmeter Käfigen in Einzelhaltung zu halten. Dies wird aber in jeder einzelnen Veröffentlichung extra erwähnt. Also werden die Hunde in den Buchten für die Schweine gehalten?

Fragen über Fragen. Wer kann diese wohl besser beantworten, als die Universität oder das zuständige Amt der Regierung von Unterfranken? Ich habe letztes Jahr viel Zeit damit verbracht die zuständigen Stellen zu einer Antwort zu bewegen und hier will ich die Bemühungen auflisten.

Kontaktversuch mit dem SG Tierschutzangelegenheiten der FAU

Zuständig für Tierschutzangelegenheiten der Friedrich-Alexander-Universität Erlangen-Nürnberg sind Mareen Ziegelmann und Dr. med. vet. Roland Jurgons. Auf meine Anfrage wurde tatsächlich am 21.08.2017 geantwortet. Auch wenn in der Antwort keine Informationen standen und sich natürlich nie wieder jemand gemeldet hat, so weiß ich es doch zu schätzen.

Kontaktversuch mit der Regierung Unterfranken

Zuerst habe ich das zuständige Veterinärwesen in Würzburg per E-Mail und mit einem Brief angeschrieben. Nach mehrmaligem Nachfragen erhielt ich diese E-Mail

Man benötigt also eine Anspruchsberechtigung, um zu erfahren, wie an einer Universität Tiere für Geld und Ruhm totgequält werden.  Ja, berechtigt bin ich scheinbar nicht und dass ich mit den Genehmigungsnummern nicht vor habe Handel zu treiben, kann ich nur schwer nachweisen. Die Nummern scheinen so geheim zu sein, dass sogar die Universität diese frei erfinden muss.

Da man mich über die falschen Nummern leider nicht aufklären wollte, habe ich die Regierung Unterfanken gebeten in dieser Sache zu ermitteln und mich über das Ergebnis in Kenntnis zu setzen

Hierauf bekam ich erst Monate später eine Antwort, nachdem ich das Bayerische Staatsministerium angeschrieben hatte.

Kontaktversuch mit dem Bayerischen Staatsministerium Umwelt und Verbraucherschutz

Mein Brief an die Ministerialrätin Frau Dr. Marscher wurde sehr freundlich beantwortet.

Worauf hin sich auch die Regierung Unterfranken noch ein letztes Mal gemeldet hat.

Kontaktversuch mit ungarischen Universitäten

Des Weiteren habe ich versucht heraus zu finden, mit welcher ungarischen Universität ein Kontakt bestehen könnte und die fünf in Frage kommenden Universitäten angeschrieben. Als einzige Universität hat das Dekanat der Universität Budapest geantwortet.

Kontaktversuch mit den Verlagen

Beim Publizieren gibt es ethische Standards für Tierversuche. Diese werden als sogenannte „ARRIVE Guidelines“ für eine Publikation gefordert. Unter anderem werden relevante Lizenzen und eine ethische Überprüfungserlaubnis gefordert. Da die Nummern der Lizenzen in den Publikationen nicht stimmen können, habe ich die relevanten Verlage darauf aufmerksam gemacht, dass ihre ARRIVE Guidelines trotz gegenteiliger Behauptung nicht eingehalten wurden.

Diese E-Mails gingen an das Journal of Cranio-Maxillofacial Surgery vom Elsevier Verlag und an das Journal of Clinical Periodontology Surgery vom Wiley Verlag.

Da Professor Dr. Friedrich W. Neukam Editor des Journal of Cranio-Maxillofacial Surgery ist, habe ich hier auch keine Antwort erwartet. Allerdings kam vom Wiley Verlag eine positive Antwort:

Kontaktversuch mit Budapest

Die Gruppe um Professor Schlegel erwähnt als einzige das „Pest county government department for food safety and animal health“ in Ungarn erwähnt, folglich muss es da wohl einen Zusammenhang geben. Professor Schlegel hat 1998 in Budapest promoviert. Damals waren in Ungarn noch „wilde“ Tierversuche möglich und einige deutsche Institute verlagerten Tierversuche deshalb nach Ungarn. Inzwischen hat sich durch das ungarische Tierschutzgesetz von 2013 und auch durch die EU vieles geändert.

Unter dem Namen „Pest county government department for food safety and animal health“ gibt es ein Amt der Regierung namens Nébih. 

Da E-Mails an die Direktoren leider keine Resonanz zeigten, habe ich einen Brief geschrieben. Es hat mich eben auch wegen der offensichtlichen Kontakte von Professor Schlegel mit diesem Amt doch erstaunt, dass ich im Februar 2018 eine kurze Antwort erhalten habe:

Die Genehmigungsnummer 54-2532.1-45/12 gibt es also dort nicht. Was auch irgendwie zu erwarten war. Der Vollständigkeit halber will ich hier noch meine Antwort und erneute Anfrage an die nébih einfügen:

Obwohl ich Ideen habe, wen ich noch anschreiben könnte, überlasse ich an diesem Punkt nach 8 Monaten Hinterfragen und Lästigsein, die Arbeitsgruppe um Professor Schlegel meinem Lieblingsverein und der Staatsanwaltschaft.

Reaktionen

Anscheinend ist von meiner Welle einiges bei den Herren angekommen. Ich vermute mal die vom Wiley Verlag. Bei ihrer neuesten Veröffentlichung, vom Dezember 2017, haben sie versehentlich wieder die gleichen Fehler gemacht.

Da ist wohl zum wiederholen Mal die falsche Nummer 54-2532.1-45/12 rein gerutscht. Jetzt da bewiesen ist, dass diese nicht stimmt, wird schnell eine neue Nummer herbei gezaubert.

Daneben wird bedauert, dass man die Tiere vor ihrem Tod nicht gemäß des Tierschutzgesetzes gehalten hat. Das war wohl nur ein Fehler im Satz. In Zukunft werden sie ihre Worte wohl besser planen, als ihre Taten.

Strafanzeige

Am 10. April 2019 hat der Verein Ärzte gegen Tierversuche e.V. Strafanzeige gegen Forscher der Friedrich-Alexander-Universität Erlangen-Nürnberg (FAU) wegen Verdachts auf Verstoß gegen das Tierschutzgesetz gestellt.

Der genaue Text der Pressemitteilung kann hier nachgelesen werden:

Ein sehr guter Artikel dazu gab es im Ärzteblatt am 11. April 2019

Es ist der totale Wahnsinn. Jetzt wären alle Studien nicht in Erlangen durchgeführt worden.

Aus der idowa von Gunnar Giftthaler am 13.04.2019:

Laut Unterlagen des Sachgebiets Tierschutzangelegenheiten der FAU habe es seit 2001 weder Versuche an Beagle-Hunden noch an Schweinen gegeben, so Pressesprecherin Dr. Susanne Langer. Es handele sich offensichtlich um an ungarischen Partnerinstitutionen durchgeführte und dort genehmigte Versuche. Dass die FAU damit in Zusammenhang gebracht werde, sei eine „möglicherweise fehlerhafte Angabe in den Publikationen.“

Was sagt die zuständige Regierung von Unterfranken zu dem Thema? „Wir sind insbesondere bei dem heiklen Thema der Tierversuche äußerst transparent“, so Pressesprecher Johannes Hardenecke gegenüber idowa. Zwischen 2007 und 2012 habe es nachweisbar keine Tierversuche gegeben, der Zeitraum zwischen 2013 und 2018 werde derzeit überprüft. 

Da hängen sicher einige Dr. Arbeiten mit drin. Das meiste hab ich ja gar nicht übersetzt, weil das mit den Schweinen und Erlangen hatte ich geglaubt. Seit 2001 keine Tierversuche mit Schweinen in Erlangen?

Jetzt bin ich erst mal sprachlos. Es ist mir noch nicht ganz klar, sind die so doof oder warum sind die so selbstsicher?

…so Pressesprecher Johannes Hardenecke gegenüber idowa. Zwischen 2007 und 2012 habe es nachweisbar keine Tierversuche gegeben, der Zeitraum zwischen 2013 und 2018 werde derzeit überprüft. 

Aus der Dissertation:

„Nach Genehmigung des Tierversuches durch die zuständige Tierversuchskommision der Regierung von Mittelfranken, Ansbach (Genehmigungsnr. 54-2531-25/07) wurden 15 Tiere in die Studie eingeschlossen, die hier auf 4 Versuchsgruppen aufgeteilt wurden. Es gab 2 Opferungszeitpunkte in der jeweils diabetische und gesunde Schweine geopfert wurden. Am ersten Opferungstermin (nach 30 Tagen Einheilung) wurden 7 Tiere (2 mit gesunder und 5 mit diabetischer Stoffwechsellage) geopfert. Nach 90 Tagen post implantationem wurden die übrigen Tiere (2 mit gesunder und 6 mit diabetischer Stoffwechsellage) geopfert.

von Tobias Möst, Erlangen, Januar 2011

….es seit 2001 weder Versuche an Beagle-Hunden noch an Schweinen gegeben, so Pressesprecherin Dr. Susanne Langer…

Im September 2019 stellt die Staatsanwaltschaft die Ermittlungen ein, da alle Versuche vor 2014 verjährt seien und bei allen Veröffentlichungen nach 2014 der Autor eingeräumt hätte, dass „Ungereimtheiten in Bezug auf Genehmigungsnummern, Genehmigungsbehörden und Ort der Tierversuche auf fehlerhafte Zitierungen zurückzuführen sind“

.

.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Mikrobiom und Glyphosat

Janauar 2018

Im Januar 2018 wurde in der Zeitschrift Science of the Total Environment eine Übersicht zur aktuellen Datenlage zu Glyphosat veröffentlicht (1). Einige Zusammenhänge waren mir neu und es ist sehr spannend zu erfahren, wie die Agrochemie mit Hilfe der Politik die Landwirte und damit auch den Steuerzahler dazu bringt, immer neue Milliarden in ein tödliches System zu stecken.

Das Prinzip ist eigentlich genial: Glyphosat (immer im Verbund mit Vernetzungsmitteln und geheimen Zusätzen) tötet alle Pflanzen und viele Mikroorganismen indem es verhindert, dass sie sekundäre aromatische Aminosäuren wie Phenylalanin, Tryptophan und Tyrosin über den Shikimatweg produzieren können.

Somit fehlen den Pflanzen die Phytoalexine, die Pflanzen gegen Krankheitserreger schützen. Folglich sterben die Pflanzen an diversen Infektionen. Sublethale Glyphosatkonzentrationen, beispielsweise aus Rückständen im Boden oder in Obstplantagen, verringern die Pflanzenresistenz gegen Krankheitserreger. Hier kommt der erste geniale Schachzug:

  • Pilzinfektionen (Fusarium, Rhizoctonia, Phytophthora etc.) kommen in mit Glyphosat belasteten Böden häufiger vor, deshalb muss der Landwirt deutlich mehr Fungizide einsetzen. Dies führt vor allem auch im Garten- und Obstanbau zu deutlichen Gewinnen der Agrochemie.

Der zweite Punkt zur Gewinnmaximierung ist etwas komplexer und aus diesem Grund schreibe ich diesen Artikel. Glyphosat ist nämlich nicht nur tödlich für alle Pflanzen, sondern auch für viele Pilze und Bakterien. Allerdings nicht für alle, was es eben so komplex macht. Glyphosat ist toxisch für manche Bakterien und Pilze die in Symbiose mit den Pflanzen leben und Nährstoffe aufschließen. So gibt es Bakterien, die Stickstoff binden und auch Pilze die Phosphat für die Pflanzen verfügbar machen. Dies ist sowohl von biologischer, als auch von wirtschaftlicher Bedeutung:

  • Manche Pilze und Bakterien werden durch Glyphosat gehemmt. In belasteten Böden muss deutlich mehr Stickstoff und Phosphat gedüngt werden. Der vermehrte Kauf von Kunstdüngern führt zu weiteren Gewinnen der Agrochemie.

Kunstdünger am Wegrand.

Mikrobiom

Als Mikrobiom bezeichnet man alle  Mikroorganismen (mikrobielle Gemeinschaft) eines spezifischen Lebensraums. So hat auch jeder Boden ein Mikrobiom, bestehend aus Bakterien, Viren, Algen, Pilzen und Protozoen. Auf das Mikrobiom beim Menschen bin ich hier und hier eingegangen.

Bodenmikrobiom

Das Bodenmikrobiom ist das erste, das von Glyphosat massiv verändert wird. So ist Glyphosat in Verbindung mit den Vernetzungsmitteln nicht nur toxisch für Amphibien und Regenwürmer, sondern auch für eine Reihe von Bakterien, Algen und Pilzen.

Einige Studien zeigen, dass Glyphosat für viele Mykorrhiza (Symbiose zwischen Pilzen und Pflanzen) toxisch ist und auch die Sporen abtöten kann (2). Bei anderen Pilzen die gerade im Pflanzenbau viel Schaden anrichten, wie z.B. Fusarium, Rhizoctonia und Phytophthora, hat Glyphosat keine Wirkung und diesen Pilzen wird hierdurch ein Vorteil verschafft. 

Die Keimung der Samen vom Blattlosen Widerbart (Epipogium aphyllum) erfolgt nur bei Infektion durch einen Wurzelpilz (Mykorrhiza).

Es gibt stickstoffbindende Bakterien, die man „Knöllchenbakterien“ nennt. Diese sind ökonomisch und ökologisch wichtige Bodenbakterien, die eine Symbiose mit Pflanzen eingehen. Nach der Bildung von Knöllchen wird symbiontisch in Leguminosen Luftstickstoff fixiert. Wichtige Gattungen sind Rhizobacteria, Sinorhizobium, Bradyrhizobium, Photorhizobium, Mesorhizobium und Allorhizobium. Manche dieser Bakterien und  auch andere, wie z.B. Burkholderia sp. werden durch Glyphosat gehemmt. Andere Arten von Rhizobium spp. und Gemmatimonas spp. werden gefördert. So können Rhizobium- und Agrobacterium-Stämme Glyphosat und andere Phosphonate abbauen. Nach einer Glyphosat Anwendung verschieben sich die Bakteriengemeinschaften, da einige Gruppen Glyphosat als Energiequelle nutzen können, während dieses Herbizid für andere Gruppen toxisch sein kann (3).

Maisfeld.

Grundwasser, Bäche und Seen

Glyphosat und sein Hauptabbauprodukt AMPA (aminomethylphosphonic acid) adsorbiert an Ton und organischen Substanzen. Der verlangsamte Abbau durch Bodenmikroorganismen führt zur Akkumulation und später zu Auswaschung durch Regen. Glyphosat- und AMPA-Abbau hängen auch stark vom pH-Wert des Bodens ab (4).

In Deutschland werden keine Studien zur Untersuchung von Glyphosat und AMPA in Flüssen finanziert. Aber eine Studie aus der Schweiz von Poiger et. al. (5) zeigt für die Schweiz, dass alle Fließgewässer mehr oder weniger stark mit Glyphosat und AMPA belastet sind.

Von beiden Verbindungen wurden regelmäßig in den untersuchten Bächen Konzentrationen von 0,11 bis zu 2,6 μg/l gefunden. Nur 40 von 583 Proben zeigten Glyphosat Konzentrationen unter dem kritischen Wert von 0,005 μg/l. Im Durchschnitt waren die Konzentrationen von AMPA höher als die von Glyphosat (5).

Die negativen Effekte von Glyphosat , AMPA und Vernetzungsmitteln auf das Ökosystem in den Bächen und Flüssen, vor allem für verschiedene Arten von Mikroalgen, aquatischen Bakterien und Protozoen wurden schon oft und eingehend beschrieben. Da es den Rahmen dieses Artikels sprengen würde, verweise ich den interessierten Leser auf Van Bruggen et al. (1), der eine gute Übersicht bietet.

Hochwasser nach Starkregen.

Mikrobiom der landwirtschaftlichen Nutztiere

Die Abwesenheit des Shikimisäureweges bei Tieren bildet die Grundlage für die Behauptung, dass Glyphosat bei Säugetieren, Amphibien und Reptilien nicht toxisch sei. Auch stammen weitere Belege aus Tierversuchen – vor allem mit Mäusen und Ratten. Dass hierbei die Abbauprodukte von Glyphosat wie AMPA, die geheimen Zusätze und die Vernetzungsmittel nicht berücksichtigt werden, erschließt sich von selbst. Ebenso haben Fütterungsversuche mit sterilen, transgenen Mäusen oder Ratten, die nach ein paar Tagen oder Wochen umgebracht werden, keinerlei praktischen Nutzen.

Der Einfluß von Glyphosat und seiner Abbauprodukte läßt sich exemplarisch am besten anhand von Kühen erläutern. Wiederkäuer haben mehrere Mägen in denen die Nahrung mikrobiell aufgeschlossen wird. Früher bestand die Nahrung aus Gras und Kräutern, heute fast ausschließlich aus Soja und Mais. Dies hat große Auswirkungen auf das Mikrobiom der Kuhmägen. Wie oben erläutert, beeinträchtigt Glyphosat die mikrobiellen Gemeinschaften.

So ist Glyphosat toxisch für Milchsäurebakterien. Diese Bakterien produzieren normalerweise Antibiotika und können pathogene Bakterien wie Clostridium botulinum unterdrücken. Sind die Glyphosat-Konzentrationen im Tierfutter also zu hoch, gibt es Botulismus bei Kühen (1, 6, 7, 8).

Botulismus bei Rindern ist in Milchviehbetrieben in den letzten Jahren gehäuft zu beobachten. Zu den Symptomen zählen Euterentzündungen, Verdauungsprobleme, vor Schmerz gekrümmte Rücken, Klauenkrankheiten, sowie Lähmungen bis hin zum Tod. Dies ist offensichtlich eine Verbindung aus falschem Futter und Glyphosat. Auch hier bezahlt den wirtschaftlichen Schaden nicht der Konsument, sondern der Steuerzahler.

Überflüssiges Bullenkalb

Die Schäden von Glyphosat auf Nutztiere lassen sich in der industrialisierten Landwirtschaft weiter fortführen. So werden bei Geflügel die Bifidobakterien und Enterokokken negativ beeinflußt und Salmonellen und Clostridien gefördert (9).

Glyphosat im Tierfutter beeinflusst nicht nur Darmbakterien sondern auch Pilze, wie z.B. die Mucorales. Mucorales können Mykosen bei Tieren und Menschen auslösen. Es konnte eine positive Korrelation zwischen den Glyphosatkonzentrationen im Urin und der Dichte von Mucorales im Pansen von Milchkühen nachgewiesen werden, da Mucorales resistent gegen Glyphosat sind (10).

Mikrobiom beim Menschen

Es konnten bei einer ganzen Reihe von Krankheiten, wie verschiedene Formen von Krebs, Nierenschäden und neurologischen Störungen (ADHS, Autismus, Alzheimer, Parkinson) eine Korrelationen zu erhöhtem Glyphosatgebrauch gefunden werden (1). Da bei diesen Krankheiten aber immer auch noch andere Faktoren mit spielen und es inzwischen auch sehr viele Veröffentlichungen hierzu gibt, will ich an dieser Stelle nur auf die Auswirkungen von Glyphosat auf das menschliche Mikrobiom eingehen.

Obwohl viele Bakterien und Pilze gegenüber Glyphosat empfindlich sind, sind andere dagegen
sehr widerstandsfähig. Bakterien und Pilze die gegen Glyphosat widerstandsfähig sind, haben meist eine besondere  „Pumpe“. Diese Pumpen, die auf Englisch „efflux pumps“ heißen, sind für Antibiotikaresistenzen bei Bakterien und auch für die Resistenz von Pilzen gegen Antimykotika verantwortlich.

Efflux-Pumpe von Bakterien pumpt störende Chemikalien wieder aus der Zelle heraus.

Bakterielle Arzneimittel-Efflux-Pumpen gibt es viele unterschiedliche und sie werden in sechs Familien eingeteilt. Diese Pumpen sind klinisch relevant, da Antibiotikaresistenzen heutzutage ein großes Problem darstellen. So kann man mit Glyphosat sehr gut auf Bakterien und auch auf Pilze selektieren, die ein gutes System von Efflux-Pumpen haben. So wird verschiedenen Krankheitserregern ein deutlicher Vorteil verschafft. Dies sind vor allem:  Pseudomonas aeruginosa, Candida albicans, Salmonella Typhimurium, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Klebsiella pneumonia, Pseudomonas putida, Enterococcus faecalis, Acinetobacter baumannii  (11).

Es ist schon länger bekannt, dass die Exposition gegenüber Bioziden indirekt eine Antibiotikaresistenz auslösen kann (12).  Ein Mikrobiom das über einen längeren Zeitraum Glyphosat ausgesetzt ist, wird sich also zwangsläufig verändern. Das Mikobiom spielt bei allen Abläufen im Körper eine bedeutende Rolle und ich habe schon öfter darüber geschieben:
http://hmjaag.de/mikrobiom
http://hmjaag.de/phageom-und-mikrobiom
http://hmjaag.de/alzheimer

Verschiedene Wirkungen des Darm Mikrobioms.

Die Auswirkungen eines Glyphosat Missbrauchs sind also vielfältig und lassen sich nicht direkt beweisen.

Was weiter zu beachten ist, und sicher viele Menschen vor negativen Folgen schützt, ist das Phageom. Viele Bakteriophagen haben die Angewohnheit über diese Efflux-Pumpen in die Bakterien einzudringen und sie so zu infizieren. Selektieren wir nun auf Bakterien mit vielen Pumpen, verschaffen wir auch den Phagen einen Vorteil. Allerdings wird das Phageom eines Menschen schon bei der Geburt festgelegt und wir haben wenig Möglichkeiten dieses zu beeinflussen.

Ein Phage befällt eine Bakterienzelle.

Für alle Menschen, die sich also nicht auf ihre Genetik und ihr Phageom verlassen wollen, empfehle ich Glyphosat und seine Abbauprodukte möglichst zu meiden und durch eine vernünftige Ernährung und Sport das Mikrobiom möglichst vielfältig zu gestalten.

(1) Environmental and health effects of the herbicide glyphosate. Van Bruggen et. al. Science of The Total Environment (2018)

(2) Glyphosate vulnerability explains changes in root-symbionts propagules viability in pampean grasslands. Druille et al. Agriculture, Ecosystems & Environment (2015)

(3) Effects of glyphosate on the bacterial community associated with roots of transgenic Roundup Ready® soybean. Arango et.al. European Journal of Soil Biology (2014)

(4) Degradation dynamics of glyphosate in different types of citrus orchard soils in China. Zhang, et al. Molecules (2015)

(5) Occurrence of the herbicide glyphosate and its metabolite AMPA in surface waters in Switzerland determined with on-line solid phase extraction LC-MS/MS. Poiger et. al. Environmental Science and Pollution Research (2017)

(6) Glyphosate suppresses the antagonistic effect of Enterococcus spp. on Clostridium botulinum. Krüger et al., Anaerobe. (2013)

(7) Detection of glyphosate residues in animals and humans. Krüger et al., . Environ. Anal. Toxicol. (2014)

(8) Oral application of charcoal and humic acids to dairy cows influences Clostridium
botulinum blood serum antibody level and glyphosate excretion in urine. Gerlach et al. J. Clin. Toxicol. (2014)

(9) Distribution of glyphosate in chicken organs and its reduction by humic acid supplementation. Shehata et al. J. Poult. Sci. (2014)

(10) Possible effects of glyphosate on Mucorales abundance in the rumen of dairy cows in
Germany. Schrödl,et al. Curr. Microbiol. (2014)

(11) Role of efflux pumps in the antibiotic resistance of bacteria embedded in a biofilm. Sara M. Soto. Journal Virulence (2013)

(12) Characterization of biocide-tolerant bacteria isolated from cheese and dairy small-medium enterprises. Fernández Márquez et al. Food Microbiol. (2017)

 

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.