Sumpfschnecke

22.04.2020

Stagnicola palustris

Die Sumpfschnecke lebt überall in Europa in stehenden Gewässern und Flußauen mit reicher Vegetation. Sie bevorzugt einen pH-Wert um 7, mag Sümpfe und flache Abflüsse, verträgt aber auch periodisch austrocknende Gewässer.

Die hier sequenzierten und beschriebenen Sumpfschnecken sind von der Höhlensteinwiese, eine Überschwemmungswiese der Breg bei Hüfingen.

Die DNA der Sumpfschnecke ließ sich lange nicht sequenzieren. So habe ich oft einen Nematoden namens Nais communis gefunden. Es ist bekannt, dass Schnecken von viele Nematoden befallen sind. Ob diese in Symbiose oder als Schmarotzer in den Schnecken leben ist nicht bekannt. Ich behaupte hier mal dreist, dass Nais communis mit Stagnicola palustris friedlich in Symbiose lebt.

Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Stagnicola palustris|21|42AF34
TAGCAGGCCGCAGTACCTTGGACTGTGCGTAAGGTAGCATAATCAATTGGCTTTTAATTGAAGTCTGGAATGAAAGGGATAATAGGAAAAAACTGTCTCAGAAAAAACTATTTGAAATTATTTAGTAAGTGAAAATACTTATATTCAGAAAAAAGACGAGAAGACCCTTAGAATTTTTATTAATAGATTCAATTTATATAAATTTTATATTTTAGTTGGGGCGACTTTGAACCATTTAAACGTTTATTAAAATACTCAACATTAAGATTTAAAAGAGCAAATTAGCTTAGGGATAACAGCATAATTTTTTATAAAGTTTGTGACCTCGATGTTGGACTAGGAACTTAATGATTAACCGTCAATATAGATTGTTCTGTTCGAACAGAAACTCCTACATGATC




d

d

d

D

d

d

d

d

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Schreibe einen Kommentar

Deine E-Mail-Adresse wird nicht veröffentlicht. Erforderliche Felder sind mit * markiert.

Wordpress Anti-Spam durch WP-SpamShield