Category Archives: Allgemein

Riemenschnecke

Riemenschnecke, Helicodonta obvoluta, Helix obvoluta

Kleine Glanzschnecke / Aegopinella pura

Die Kleine Glanzschnecke kommt im Hochsommer zu hunderten auf die reifen Johannisbeeren in meinem Garten. Die winzige Schnecke ist allerhöchstens 5 mm groß.

Die Fortpflanzung sei im Frühjahr, erwachsene Tiere sterben nach Eiablage, Jungtiere werden nach 2 Jahren geschlechtsreif (Schwer 1994). Warum also die Tiere im Hochsommer auf die Johannisbeeren steigen bleibt deren Rätsel. Vielleicht werden die Eier im Frühjahr an die Pflanzen gelegt und die Jungtiere steigen dann auf, um im Herbst mit den Blättern auf dem Boden zu überwintern.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Schwarzer Schnegel/ Limax cinereoiger

Der sehr große Schnegel kann auch in grau oder weißlich vorkommen. Die Tiere haben eine dreigeteilte Sohle, deren äußere Felder dunkler sind. L. Cinereoiger ist die größte einheimische Nacktschnecke und kann bis 30 cm lang werden.

Dieser hier war an der Donauversickerung bei Geisingen.

Limax cinereoiger

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Posthornschnecke / Planorbarius corneus

Die Posthornschnecke ist eine Wasserlungenschnecke.

Planorbarius corneus erreicht mit den 4 bis 5 Windungen bis zu 4 cm.

Die Atmung erfolgt hauptsächlich über die Haut, daher kommen Posthornschnecken bei ausreichend sauerstoffhaltigem Wasser seltener als andere Wasserschnecken an die Oberfläche, um Luft zu holen. Am Kopf kann man die beiden nicht einziehbaren Fühler sehen, wobei sich die Augen an deren Basis befinden. Zusätzlich besitzen sie auch deutlich ausgeprägte Lippen.*


Posthornschnecke beim Mühlebach in Hüfingen

Sollte ein Austausch der Atemluft notwendig werden, so lassen sich die Tiere von der höchsten Blattspitze an einem Schleimfaden zur Wasseroberfläche treiben. Nach erfolgter Atmung wird derselbe Schleimfaden für den Rückweg benützt, auch andere Artgenossen verwenden diesen Weg zur Wasseroberfläche.*

Posthornschnecke beim Mühlebach in Hüfingen

Der Körper dieser Schnecke ist fast schwarz, sie ist jedoch die einzige europäische Vertreterin, deren Blut durch Hämoglobin rot gefärbt ist. Gelegentlich kommen unpigmentierte Exemplare vor, dann erscheint der Körper durch das Hämoglobin leuchtend rot. Durch diese Besonderheit kann die Posthornschnecke auch in sehr sauerstoffarmen Gewässern überleben.*

Posthornschnecke beim Mühlebach in Hüfingen

Nach: https://www.donauauen.at/wissen/natur-wissenschaft/fauna/posthornschnecke-planorbarius-corneus

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


Baumschnecke

Arianta arbustorum

Die Baumschnecke hieß früher Helix rufescens (Lais 1925) und wird auch Gefleckte Schnirkelschnecke oder Baumschnirkelschnecke genannt und ist noch relativ häufig.

Ähnlich wie auch die Bänderschnecken soll Arianta arbustorum durch Drosseln verbreitet werden.

Unsere hier war auf dem Weg neben dem Römerbad in Hüfingen zu finden.



Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Arianta arbustorum|26|42AF40
TAAGTTGACTTATAATTGAAGTCTAGAATGAATGAATATACGGGCAGCAACTGTCTCAAAAGTATTTTTGCTAATTTAGTTACCAAGTGCAAATACTTGAAGTTATAAAAAAGACGAGAAGACCCTAGAAACTTAATTAATTTTGTTGGGGCGACAGAATTACAATATAAACTAATTTTCTATTACAGGAAACGTAGGTGAAAGAGCAAGTTACTCTAGGGATAACAGCGTAATTTAATTTAAGTTTGCGACCTCGATGTTGGACTAGGTATAGTAGTTTTTA









Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Märzenschnecke

01.05.2020

Zebrina detrita

Die Märzenschnecke wird auch als Weiße Turmschnecke, Zebraschnecke oder Kaiserstuhlschnecke bezeichnet und gehört zur Familie der Vielfraßschnecken.

Die Märzenschnecke bevorzugt sonnige und trockene Standorte wie Magerrasen und Weinberge. Deshalb wurde sie im Kaiserstuhl von den Winzern nahezu ausgerottet.

Die Märzenschnecke wird in Deutschland als stark gefährdet angesehen und steht auf der Roten Liste Kategorie 2.

Unsere Märzenschnecke hier lebt auf dem Magerrasen am Hang vom Fürstenberg.

Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Zebrina detrita|24|42AF37
GTGCTATCCTGCCCGGTGATTTTGTTTAACGGCCGCAGTACTTTGACTGTGCTAAGGTAGCATAATCACTTGTCTTTTAAATGGGGACTGGAATGAAAGGATGTTTGGATTGAGGCTGTCTTCATACTACTTATATTAAATTGCTAAAGGGGTGAAAATTCCCCTAATGGAACATTAGACGAGAAGACCCTTAGAATTATTACAAAAATAGTGTTAACTATGAAGTGTTTGTTGGGGCAACAGGGTATTTATATAACATACTTATATATATATGTAAACAAGCAGATAATTTTATGCATGAATAATTACCTGAGGGATAACAGCATAATTTACTATAAGATTGTGACCTCGATGTTGGACTAAGGAGTTAACTTATTAGACGTAAGTTAAGATGGTTCTGTTCGAACCCTGTACCTTACATGATCTGAGTTCAGACCGG





Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


Sumpfschnecke

22.04.2020

Stagnicola palustris

Die Sumpfschnecke lebt überall in Europa in stehenden Gewässern und Flußauen mit reicher Vegetation. Sie bevorzugt einen pH-Wert um 7, mag Sümpfe und flache Abflüsse, verträgt aber auch periodisch austrocknende Gewässer.

Die hier sequenzierten und beschriebenen Sumpfschnecken sind von der Höhlensteinwiese, eine Überschwemmungswiese der Breg bei Hüfingen.

Die DNA der Sumpfschnecke ließ sich lange nicht sequenzieren. So habe ich oft einen Nematoden namens Nais communis gefunden. Es ist bekannt, dass Schnecken von viele Nematoden befallen sind. Ob diese in Symbiose oder als Schmarotzer in den Schnecken leben ist nicht bekannt. Ich behaupte hier mal dreist, dass Nais communis mit Stagnicola palustris friedlich in Symbiose lebt.

Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Stagnicola palustris|21|42AF34
TAGCAGGCCGCAGTACCTTGGACTGTGCGTAAGGTAGCATAATCAATTGGCTTTTAATTGAAGTCTGGAATGAAAGGGATAATAGGAAAAAACTGTCTCAGAAAAAACTATTTGAAATTATTTAGTAAGTGAAAATACTTATATTCAGAAAAAAGACGAGAAGACCCTTAGAATTTTTATTAATAGATTCAATTTATATAAATTTTATATTTTAGTTGGGGCGACTTTGAACCATTTAAACGTTTATTAAAATACTCAACATTAAGATTTAAAAGAGCAAATTAGCTTAGGGATAACAGCATAATTTTTTATAAAGTTTGTGACCTCGATGTTGGACTAGGAACTTAATGATTAACCGTCAATATAGATTGTTCTGTTCGAACAGAAACTCCTACATGATC



Ein Stück weiter am Mühlebach in Hüfingen im Gewässer eines Spielplatzes gibt es auch noch Sumpfschnecken:

dA

d

d

D

d

d

d

d

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Bernsteinschnecke

06.06.2022

Succinea putris

Die Succinaeidae haben große, dünnschalige Gehäuse.
In den Wutachflühen soll es zwei Arten der Bernsteinschnecke geben. Die andere Art ist deutlich dunkler und bis jetzt habe ich sie noch nicht gefunden.

Bernsteinschnecke in den Wutachflühen

Die Bernsteinschnecke mag es sehr feucht und lebt deshalb gerne am Flüssen und Bächen. Diese Schnecken kommen in allen möglichen Farben und Schattierungen. Die unten lebt in der Böschung der Breg bei Bräuningen.

d

d

d

D

dlkjd

dd

d

d

d

d

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.