Category Archives: Allgemein

Literaturrecherche Mobilfunk

19.08.2019

Da doch einige Behauptungen und Annahmen durch die Presse rauschen von wegen schädlich oder nicht schädlich vom Mobilfunk, habe ich mich dem Thema über die wissenschaftliche Literatur genähert. Hierfür habe ich die Veröffentlichungen von Januar-August 2019 herausgesucht und gelesen. Dabei habe ich sieben wissenschaftliche Veröffentlichungen gefunden die relevant wären und die ich hier kurz besprechen möchte.

Die erste Studie hat mich selber überrascht, es ist eine Studie aus Schweden bei der bei über 24.000 Menschen Kopfschmerzen, Tinnitus und Schwerhörigkeit in Bezug auf die Nutzung von Mobiltelefonen untersucht wurde (1).

Resultat der schwedischen Studie: Personen, die am häufigsten Mobiltelefone verwendeten, berichteten etwas häufiger über wöchentliche Kopfschmerzen als andere Benutzer. Dieser Befund verschwand jedoch nach Anpassung der Störfaktoren weitgehend und hing nicht mit der Anrufdauer bei GSM mit höheren HF-Frequenzen zusammen. Tinnitus und Hörverlust waren nicht mit der Anrufdauer verbunden.

In der zweiten Studie wurden die kognitive Fähigkeiten bei Kinder mit Handy untersucht (2).

Die Autoren sagen, dass frühere epidemiologische Studien zu gesundheitlichen Auswirkungen der Strahlenexposition von Mobiltelefonen zu inkonsistenten Ergebnissen geführt hätten.

Es wurden 619 Schüler zu Studienbeginn rekrutiert und Längsschnittdaten für 412 Schüler aus einer repräsentativen Stichprobe von 36 staatlichen, privaten und katholischen Schulen erhoben.

Es gab kaum Anhaltspunkte für einen signifikanten Zusammenhang zwischen der Nutzung von Mobiltelefonen und der kognitiven Leistung von Schülern (2).

Eine dritte Studie bietet einen ganz guten Überblick über die elektromagnetische Felder in verschiedenen Umgebungen und erläutert diese (3).

Bei einer vierten Studie wird es wieder spannender, weil es geht um Tumore des Gehirns und der Speicheldrüse und Verwendung von Mobiltelefonen (4). Hier handelt es sich um eine sogenannte „Meta-Studie“. Die Veröffentlichung kombiniert eine Vielzahl von Studien in einer Zusammenschau. Hier die Ergebnisse der Studie:

Zusammenfassend lässt sich sagen, dass die aktuellen Erkenntnisse aus allen verfügbaren Studien, einschließlich in-vitro-, in-vivo– und epidemiologischen Studien, keinen Zusammenhang zwischen dem Mobiltelefon Konsum und Tumoren erkennen lassen, die sich aus den am stärksten exponierten Organen und Geweben entwickeln. Angesichts des großen Forschungsaufwands zu diesem Thema ist davon auszugehen, dass potenziell nicht erkannte Risiken aus individueller Sicht gering sind und lange Latenzzeiten (> 15 Jahre), seltene Gehirntumorsubtypen und Mobiltelefon-Konsum im Kindesalter betreffen können. Um diesen geringen Risiken zu begegnen, ist eine qualitativ hochwertige Forschung mit genauer Expositionsabschätzung erforderlich, wobei zu berücksichtigen ist, dass die Dauer des MP-Anrufs allein die HF-EMF-Exposition des Gehirns nicht angemessen widerspiegeln wird.

Bei der 5. Studie geht es auch wieder um Krebs, insbesondere um diverse Hirntumore (5).

In einer populationsbasierten ökologischen Studie wurden die Trends von Hirntumoren in den Zeiträumen 1982–1992, 1993–2002 und 2003–2013 untersucht. Die Schlussfolgerungen der australischen Wissenschaftler ergaben keine Zunahme von Gehirntumor-Histologietypen oder Gliomlokalisationen, die auf Mobiltelefone zurückgeführt werden können.

Dann in der 6. Studie ergaben sich dann doch Auswirkungen von Mobilfunkmasten neben Schulen auf die Konzentrationsfähigkeit von Schulkindern (6). Allerdings gibt der Autor – ein Professor Sultan Ayoub Meo von der King Saud Universität in Riad – zu, dass seine Statistik mangelhaft sei. Er belegt seine Aussagen dann aber mit einigen hochkarätigen Veröffentlichung unter anderem einer vom Max-Planck-Institut für neurologische Forschung (7).

Bei dieser 13-seitigen Veröffentlichung scheint es sich um sowas wie ein Standardwerk zu handeln. Es wird sowohl die Blut-Hirn Schranke genau behandelt wie auch alle anderen physiologischen und neurologischen Zusammenhänge. Ich will hier nur kurz die Schlussfolgerungen des Max-Planck-Institut für neurologische Forschung aus (7) zusammenfassen:

Gegenwärtig gibt es kaum Hinweise darauf, dass eine gepulste oder kontinuierliche Mikrowellenexposition bei Leistung und Frequenzen im Zusammenhang mit der Mobilkommunikation die Funktionsfähigkeit und strukturelle Integrität des Gehirns beeinträchtigen könnte. Unter experimentellen Bedingungen konnten die meisten der bisher gemeldeten positiven Ergebnisse auf thermische Effekte zurückgeführt werden. Es ist unwahrscheinlich, dass solche Effekte bei regelmäßiger Verwendung von Mobiltelefonen auftreten, da die emittierte Gesamtleistung viel zu niedrig ist, um die Körpertemperatur zu erhöhen, und weil lokale Erhöhungen der Gehirntemperatur, falls vorhanden, durch die thermostabilisierende Wirkung des zirkulierenden Blutes verhindert würden.

Andere biologische Störungen, die unter Versuchsbedingungen beobachtet werden, können mit verfahrensbedingten Nebenwirkungen wie Immobilisierungsstress zusammenhängen, unter denen nicht betäubte Tiere leiden. Versuchsanordnungen sollten daher so konzipiert werden, dass die tatsächlichen Expositionsbedingungen für menschliche Benutzer von Mobilkommunikationssystemen nachgebildet werden.

Ebenso sind Wechselwirkungen mit menschlichem Verhalten oder neurologischen Erkrankungen bestenfalls minimal. Insbesondere konnte kein signifikanter Zusammenhang mit der Inzidenz oder dem Wachstum von Hirntumoren unter experimentellen oder klinischen Bedingungen hergestellt werden. Negative Daten schließen die Möglichkeit geringfügiger mikrowelleninduzierter biologischer Wirkungen auf das Gehirn nicht aus. Je geringer diese Nebenwirkungen sind, desto geringer ist ihr Beitrag zum kombinierten Gesundheitsrisiko, das andere Umwelteinflüsse auf das Gehirn ausüben können. Diese Schlussfolgerung steht möglicherweise im Widerspruch zu den offensichtlichen, aber wenig untersuchten Stressreaktionen, die viele Personen erfahren, wenn sie sich über rücksichtslose Benutzer von Mobiltelefonen ärgern. Beträchtliche Gesundheitsrisiken ergeben sich auch aus der hohen Anzahl von Verkehrsunfällen, die durch Mobiltelefonie während der Fahrt verursacht werden. Weitere Forschungen sollten sich daher auf diese indirekten Auswirkungen der Mobiltelefonie konzentrieren, die sich letztendlich als schwerwiegendere Belastung für die Gesundheitssysteme herausstellen können als die vermutlich vernachlässigbaren biologischen Störungen.

Professor Sultan Ayoub Meo will seine Studie mit einer weiteren wichtigen amerikanischen Veröffentlichung belegen. In dieser Studie wurde schon 2004 gezeigt, dass die aktuellen Beweise für einen ursächlichen Zusammenhang zwischen Krebs und Exposition gegenüber Hochfrequenzenergie schwach und nicht überzeugend sind (8).

Fazit aus der Recherche von Januar-August 2019

Die einzige wissenschaftliche Veröffentlichung von 2019 die den Mobilfunk kritisch sieht, hat nicht nur keinerlei Beweise für die Behauptung, sondern in den zitierten Journals steht auch das Gegenteil der Behauptung.

Umweltauswirkungen

Die siebente Veröffentlichung dieses Jahr, die ich zu diesem Thema gefunden habe, war ein hoch interessanter Übersichtsartikel über verschiedene Strahlungen und deren Auswirkungen auf Insekten (9).

Jedem Interessierten rate ich, diesen Artikel mal anzuschauen. Es wird einsichtlich in Diagrammen erklärt, was es überhaupt für Strahlung gibt und wie sich sich auswirken.

Was bei dem Artikel deutlich raus kommt:

Die Lichtverschmutzung ist unser größtes Problem!

Zusammenfassung

Es gibt entgegen vielen Behauptungen einen wissenschaftlichen Konsens in Sachen Mobilfunk. Von daher hat die Neue Zürcher Zeitung (NZZ) natürlich Recht. Ich empfehle dringen allen, die sich erst mal einen Überblick auf Deutsch verschaffen wollen die Lektüre des hervorragend Artikels von Andreas Hirstein am 27.04.2019 in der NZZ


(1) Headache, tinnitus and hearing loss in the international Cohort Study of Mobile Phone Use and Health (COSMOS) in Sweden and Finland (July 2019); International Journal of Epidemiology; Anssi Auvinen et al.; https://doi.org/10.1093/ije/dyz127

(2) Uncertainty Analysis of Mobile Phone Use and Its Effect on Cognitive Function: The Application of Monte Carlo Simulation in a Cohort of Australian Primary School Children (July 2019);
Int. J. Environ. Res. Public Health 2019, 16(13), 2428; https://doi.org/10.3390/ijerph16132428

(3) Radio Frequency Electromagnetic Fields Exposure Assessment in Indoor Environments: A Review (März 2019)
Int. J. Environ. Res. Public Health 2019, 16(6), 955; https://doi.org/10.3390/ijerph16060955

(4) Brain and Salivary Gland Tumors and Mobile Phone Use: Evaluating the Evidence from Various Epidemiological Study Designs. (April 2019); Annual Review of Public Health Volume 40, 2019 Röösli, pp 221-238;
https://www.annualreviews.org/doi/full/10.1146/annurev-publhealth-040218-044037

(5) Mobile phone use and incidence of brain tumour histological types, grading or anatomical location: a population-based ecological study. (Dezember 2018); Public health; Ken Karipidis et al;
https://bmjopen.bmj.com/content/8/12/e024489.long

(6) Mobile Phone Base Station Tower Settings Adjacent to School Buildings: Impact on Students‘ Cognitive Health (Januar 2019); American Journal of Men’s Health; Sultan Ayoub Meo et al;
https://journals.sagepub.com/doi/full/10.1177/1557988318816914

(7) Effects of Electromagnetic Radiation of Mobile Phones on the Central Nervous System (2003); Bioelectromagnetics 24:49 ^ 62
https://onlinelibrary.wiley.com/doi/abs/10.1002/bem.10068

(8) Mobile phones, mobile phone base stations and cancer: a review (2005); International Journal of Radiation Biology https://www.tandfonline.com/doi/abs/10.1080/09553000500091097

(9) Risk to pollinators from anthropogenic electro-magnetic radiation (EMR): Evidence and knowledge gaps; Science of The Total; Volume 695, 10 December 2019; Environmenthttps://doi.org/10.1016/j.scitotenv.2019.133833


Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Öffentliche Stellungnahme zur Änderung der 6. Änderung des Flächennutzungsplans 2020

Sehr geehrte Herren,

auf meine letzte Stellungnahme habe ich leider keine Antwort erhalten. Die Abwägung musste ich über mehrere Ecken „erbeuten“. Warum sollte die Abwägung geheim bleiben? Haben Sie sich etwa für die Polemik geschämt? Kann ich verstehen.

Der GVV repräsentiert nicht die Bevölkerung, sondern nur das südbadische Patriarchat und damit als Teil davon den Industriellen vom Palmhof mit seinem bezahlten Herrn für die gesetzlich vorgeschriebenen Umweltberichte. Der Palmhof lebt schon lange auf Kosten der Tiere und der Umwelt und damit auch auf Kosten der nächsten Generation. In diesem Sinne wurde keine Prognose für das Grundwasser erstellt.

Natürlich geht von der Anlage im störungsfreien Regelbetrieb direkt keine Verschlechterung des Grundwassers aus. Aber um die Anlage „zu füttern“ wird intensivst Ackerbau betrieben. Dabei werden unter anderem der sogenannte wertvolle Dünger (die Reste der Biogasanlage) auf die Felder ausgebracht. Und genau hier ist die Auswirkung der Vergrößerung der Biogasanlage auf das Grundwasser zu berücksichtigen.

Der Schaafäcker ist seit 1.1.2017 nach §5 Abs. 3 SchALVO Nitrat-Problemgebiet. Im Umweltbericht wird behauptet das sei noch nicht rechtskräftig, jetzt wird behauptet das sei nicht nachvollziehbar. Die Meinung des Herrn ist da irrelevant. Auch geht es nicht um den Ist-Zustand unseres Trinkwassers, sondern um den Zustand des Trinkwassers, nachdem die Planung duchgedrückt wird. Ich verlange hierfür eine Prognose eines Sachverständigen!

Niemand hat etwas gegen Abfälle in einer Biogasanlage. Dafür wurden sie einmal konzipiert. Es geht um den Mais, für dessen Monokultur die Böden zerstört werden und das Grundwasser verseucht wird.

Der Anbau einjähriger Pflanzen für Biogasanlagen ist nicht nachhaltig!* Dies ist wissenschaftlicher Konsens. Die Biogaslobby stellt sich mit dem Maisanbau und dem damit verbundenen Schwerverkehr nicht nur gegen die eigene Bevölkerung, sondern auch gegen alle wissenschaftlichen Erkenntnisse.

Auch wenn ich auf die polemische Abwägung hier nicht weiter eingehen will, würde mich doch brennend interessieren, wie der Herr den Satz „Das Ausbringen „vielfältiger Chemikalien“ zum Beispiel zur Steigerung der Erntemasse ist ausgeschlossen“ wohl gemeint hat? Es wäre nett, wenn die Herren sich in Zukunft jemand suchen würden, der zumindest weiß, was Chemie bedeutet.

Für Ihre Pläne in der Zukunft: Privilegiertes Bauen im Außenbereich geht nur, wenn das Futter überwiegend selbst erzeugt wird. Da Sie nichts zur Steigerung der Erntemasse ausbringen wollen, wird dies schwierig werden. Ihre Drohung zur Strafe in Zukunft alles noch intransparenter als jetzt durchzuziehen, wird uns in der Opposition nicht hindern, sondern eher noch wachsamer machen.

Mit freundlichen Grüßen

* Serena Croce et al. : Anaerobic digestion of straw and corn stover: The effect of biological process optimization and pre-treatment on total bio-methane yield and energy performance, Biotechnology Advances (2016)


Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


Öffentliche Stellungnahme zur 6. Änderung des Flächennutzungsplans 2020

An den Gemeindeverwaltungsverband Donaueschingen

Sehr geehrte Herren,

am Mittwoch, 22. Mai 2019, wurde die öffentliche Auslegung der 6. Änderung des Flächennutzungsplans 2020 des GVV Donaueschingen, veröffentlicht.

Zur geplanten Änderung des Flächennutzungsplans nehme ich wie folgt Stellung und möchte um Berücksichtigung und Prüfung der gesetzlichen Grundlagen bitten.

Der Flächennutzungsplan soll dahingehend geändert werden, dass der Palmhof u.a. die Leistung der Gaserzeugung der Biomasseanlage von 2,3 Mio Nm3/a Biogas auf bis zu 6 Mio Nm3/a Biogas erhöhen darf. Dies bedeutet eine Verdreifachung der Gebäude, Maschinen und Anlagen und schließt einen Ankauf oder Pachtung von neuen Ackerflächen für den Betrieb ein. Da zwischen Schellenberg und Sieren bereits ein fast durchgehender Maisacker besteht, werden hierfür neue Ackerflächen erschlossen werden, die sich in bis zu 20 km Entfernung befinden. Diese werden mehrmals jährlich mit schwerem Gerät angefahren; nicht nur zum Säen und Ernten, sondern auch, um vielfältige Chemikalien auszubringen. Des Weiteren muß die dreifache Menge an Gärresten auf den Äckern ausgebracht werden.

 Ausbringung von landwirtschaftlichen Abfällen in die Sierenquelle.

Sierenquelle

Rund 250 m östlich vom Palmhof befindet sich das Wasserschutzgebiet Schaafäcker. Das Wasserschutzgebiet beziehungsweise das Einzugsgebiet des Trinkwasserbrunnen Schaafäcker wird als Nitrat-Problemgebiet gelistet. Dies bedeutet, dass die Nitratkonzentration bei mindestens 35 mg/Liter Rohwasser (im Mittel von 2 Jahren) liegt. Deshalb bestehen für das WSG Schaafäcker seit dem 1.1.2017 besondere Schutzbestimmungen nach § 5 SchALVO.

Wie Ihnen bekannt sein dürfte, verstößt die Bundesrepublik Deutschland und hier auch die Stadt Hüfingen gegen die EU-Nitratrichtlinie und ein neues Vertragsverletzungsverfahren droht. Vor dem Hintergrund, dass der Schaafäcker schon jetzt zu stark belastet ist, ist der geplante Ausbau der Biogasanlage auf dem Palmbuck und der damit einhergehenden weiteren Intensivierung (insbesondere der Erhöhung der Düngung) der landwirtschaftlichen Nutzung eine potentielle Gefährdung des Trinkwassers von Hüfingen und des Trinkwassers der nächsten Generationen.

Weiterführende Informationen: Umsetzung der Nitrat-Richtlinie

Des Weiteren gibt es eine landesweite Biotopverbund-Planung, die im Umweltbericht nicht berücksichtigt wird. Im geplanten Sondergebiet befindet sich im westlichen Teilbereich ein Kernraum der Verbundplanung für trockene Standorte. Dieser Korridor verbindet das NSG Palmenbuck und das FFH-Gebiet mit geschützten Biotopen. Im östlichen Bereich des Sondergebietes soll großflächig ein Suchraum der Biotopverbund-Planung für trockene Standorte in Anspruch genommen werden.

Kernfläche und Suchraum der Biotopverbundplanung

Gemäß der Biotoperhebungsbögen für die angrenzenden geschützten Biotope und das NSG Palmenbuck kommen mehrere Tier- und Pflanzenarten der Roten Listen vor:

Deutscher NameRote Liste BW
Wanstschrecke2 (stark gefährdet)
Bluthänfling3 (gefährdet)
Himmelblauer Bläuling3 (gefährdet)
Fliegen-Ragwurz3 (gefährdet)
Rosmarin-Seidelbast2 (stark gefährdet)
Rotbraune Stendelwurz3 (gefährdet)
Kreuz-Enzian2 (stark gefährdet)
Fransen-Enzian3 (gefährdet)
Küchenschelle3 (gefährdet)
Eberwurz3 (gefährdet)

Im Umweltbericht wird die landesweite Biotopverbund-Planung nicht erwähnt und die Auswirkungen des Vorhabens auf die Verbundfunktion nicht berücksichtigt! Dies stellt einen erheblichen fachlichen Mangel dar, da die geplante Versiegelung und Bebauung die Isolation der naturschutzfachlich wertvollen und geschützten Arten und Biotope bedeutet. Diese Isolierung der Populationen wird zu einer genetischen Verarmung (mangelnder Austausch mit anderen Populationen) und zu einem Erlöschen der Populationen und damit zu einer weiteren Verarmung der Biodiversität führen. Dies ist vor allem vor dem Hintergrund der weiten Entfernung zu den nächsten trockenen Standorten (ca. 1 km entfernt, Sieretal) eine reale Gefährdung.

Grundsätzlich stelle ich in Frage, ob die vorliegende FFH-Verträglichkeitsvorprüfung ausreichend ist. Ebenfalls ist zu prüfen, in wie weit das UVPG greift, das für Biogasanlagen, je nach Größe, eine allgemeine oder eine standortbezogenen Vorprüfung des Einzellfalls oder ein Umweltverträglichkeitsprüfung vorsieht.

Laut Umweltbericht können erhöhte Stickstoffeinträge zu einer Nährstoffanreicherung und damit zu einer negativen Beeinflussung der Flora des FFH-Gebiets 7916-311 „Baar, Eschach und Südostschwarzwald“ führen. 

Der Zustand des Hüfinger Grundwassers wird nicht berücksichtigt. Indirekte Auswirkungen auf das Schutzgut Grundwasser im Bereich der Zulieferflächen für die Gärsubstrate seien im Rahmen des Umweltberichts nicht bewertbar.

Weil die Auflagen für das WSG Schaafäcker angeblich noch nicht rechtskräftig seien, oder das Ausbringen der Gärreste nicht bewertbar sei, sollen Tatsachen geschaffen werden! Dies ist nicht hinnehmbar!

Deshalb fordere ich den Verzicht auf die Ausweisung des Sondergebiets zum Schutz des Trinkwassers und zum Erhalt der lokalen Biodiversität.  

Meine Minimalforderung ist die Berücksichtigung der Biotopverbundplanung.

Dies bedeutet:

  • Herausnahme des Kernraumes der landesweiten Biotopverbund-Planung aus dem Sondergebiet
  • Ersatz-/Ausgleichsmaßnahme für den Verlust des Suchraumes im Westen bzw. Herstellung eines entsprechenden Biotopverbundes im Osten des Sondergebietes.

Ich bitte um Beachtung meiner Stellungnahme, weitere Beteiligung am Verfahren (auch zum Bebauungsplan „SO Palmhof“) und die Unterrichtung über das Ergebnis der Abwägung der eingegangenen Stellungnahmen.

Bei Rückfragen stehe ich Ihnen gerne zur Verfügung.

Mit freundlichen Grüßen

Dr. Hannah Miriam Jaag

.

.

.


Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Helix pomatia

Weinbergschnecke

Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Voucher 09
Voucher 09




.

.

.

.

.

.

.

.

.

.

>Helix pomatia|09|42AF10
TATAGTTATTTCTGCTCATGACTTAAATAGCCGCAGTACTCTGACTGTGCAAAGGTAGCATAATCAGTTGGCTTTTAATTAGAGTCTGGTATGAACGAAAATATGGGTAGTAACTGTCTTAGCACATTTTTTCGAACTTATTAAACAAGTGCAAATGCTTGTAATTTAACAATAGACGAGAAGACCCTAGAAACTTGGACAAGTTTTTGTTGGGGCGACAGAATTACACTTAACTAATCTTATAATACACGACGCGATGTTGAAAGAATAAGTTACTCTAGGGATAACAGCATAATTTCATTAGTTTGTGACCTCGATGTTGGACTAGGTACTATACCCTTAAGGCAAGGATATATTATGCTCTGTTCGAGCAAAATTACCTACATGATCTGAGTTCAGACCGGAGTCCT

.

.

Voucher 10

.

ö


.öö

ö

ö

ö

ö

ö

ö

ö

öö

ü

ü

ü

>Helix pomatia|10|42AF15
ATAGTTATTTCTGCTCATGACTTAAATAGCCGCAGTACTCTGACTGTGCAAAGGTAGCATAATCAGTTGGCTTTTAATTAGAGTCTGGTATGAACGAAAATATGGGTAGTAACTGTCTTAGCACATTTTTTCGAACTTATTAAACAAGTGCAAATGCTTGTAATTTAACAATAGACGAGAAGACCCTAGAAACTTGGACAAGTTTTTGTTGGGGCGACAGAATTACACTTAACTAATCTTATAATACACGACGCGATGTTGAAAGAATAAGTTACTCTAGGGATAACAGCATAATTTCATTAGTTTGTGACCTCGATGTTGGACTAGGTACTATACCCTTAAGGCAAGGATATATTATGCTCTGTTCGAGCAAAATTACCTACATGATTGAGTTCAGACCGG

ö

ö

Chromatogramm von Voucher 10

ö

ö

ö

üppp

ü

ü

ü

ü

ä

FFFFFF

äüüü

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.

p

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Zerstörungen durch den FF Forst

08.05.2019

Da im Forst bei Bräunlingen, mit dem Namen Habseck, schon seit geraumer Zeit massiv die Natur zerstört wird und die Verstöße leider keinen interessieren, will ich hier eine Dokumentation über die Zerstörung des Waldes, des Bodens, der Flora und Fauna auf der Gemarkung Mistelbrunn durch den Fürstenberg Forst machen.

Schon im Jahr 2016 fiel mir auf, dass auf den Flurstücken 64 Gemarkung Mistelbrunn, Tümpel mit Kaulquappen zugeschüttet wurden. Dies geschah im Frühjahr – also Mai 2016 – ; ich wollte nach den Kaulquappen dort sehen und fand nur noch zugeschüttete Gräben. Leider habe ich damals weder die Kaulquappen noch die Zerstörungen dokumentiert.

Als an Ostern 2019 Öl in einen Bach floss dachte ich das zu ändern.

Hier Aufnahmen vom 19. April 2019:

Mit diesen Fotos ging ich gleich am 20.04.2019 zur Polizei Donaueschingen, damit das Öl nicht weiter in den Bach fließt.

Die Polizei ließ dies durch den Forst untersuchen und die Feuerwehr hat einen Schnelltest auf Schweröl gemacht, der negativ war. Weiter vermeldete die Polizei: „Unabhängig davon wurde in Erfahrung gebracht, dass die Forstgeräte (in diesem Fall wäre es ein Vollernter gewesen) im professionellen Bereich ausschließlich Bio-Hydrauliköl und Bio-Sägekettenöl betrieben werden dürfen. Diese Öle sind biologisch abbaubar. Zudem gilt ein gewisser Verlust während der Arbeiten als normal.“

Das Naturschutzamt vermeldete:

„…Ihre Meldung geprüft wurde, können wir Ihnen bestätigen, dass  die Gewässerverunreinigung nicht durch Öl, sondern durch Huminstoffe verursacht wurde, die infolge eines forstlichen Einsatzes freigesetzt wurden.“

Also flossen Huminstoffe in den Bach. Den Bachlauf hatte ich am 19.04.2019 allerdings fotografiert, da dort Bergmolche (Ichthyosaura alpestris), Laich und Kaulquappen vorhanden waren.

Am 05.05.2019 war dieser Bachlauf zerstört.

Da ich beim Naturschutzamt schon Ostern eine Meldung gemacht hatte und darauf nicht eingegangen wurde. Habe ich am 08.05. eine etwas präzisere Meldung gemacht.

Bezugnehmend auf die § 14 (2), § 5 (2), § 5 (3), § 44 (1) des Bundesnaturschutzgesetzes (BNatSchG) sowie § 17 des Tierschutzgesetz (TierSchG) und § 11 des Bundeswaldgesetz (BWaldG) meldete ich den Fürstlich Fürstenbergischen Forst (FF Forst). Die zur Anzeige kommenden Handlungen wurden auf dem Flurstück 64, Gemarkung 6172 Mistelbrunn, durchgeführt.

Die hügelbauenden Waldameisen gehören in Deutschland nach der Bundesartenschutzverordnung (BArtSchV) zu den besonders geschützten Tierarten. Dieser allgemeine Schutz ergibt sich aus § 44 (BNatSchG). Demnach dürfen sie nicht der Natur entnommen oder gar getötet werden. Jeder Eingriff in die Neststruktur ist strengstens untersagt. Auf den oben genannten Flurstücken wurden mehrere Ameisenhügel zerstört. Zum Teil sogar neben der bearbeiteten Forstfläche. Die Fläche wurde ohne ersichtlichen Grund mit Geräten mittig überfahren.

Der Bach in den an Ostern Baumöle abflossen, habe ich am 19. April 2019 dokumentiert. Es befanden sich dort Bergmolche, Laich und Kaulquappen unbekannter Art. Dieser Bachlauf wurde von schweren Erntemaschinen zerstört, indem längs durchgefahren wurde. Deshalb erstatte ich Anzeige wegen Verstoß gegen § 17 TierSchG da Wirbeltiere ohne vernünftigen Grund getötet wurden. Sowie wegen Verstoß gegen § 44 (1) (BNatSchG) da wild lebende Tiere getötet wurden und ihr Habitat zerstört wurde. Dass der Forst dort Habitate zuschüttet ist in den letzten Jahren wiederholt zu beobachten gewesen.

Laubbäume werden wie Unkraut gefällt und liegen gelassen. Das Waldbiotop Bruderbächle wird mit Ernteabfällen und Unrat voll gekippt. Auf den verdichteten Böden werden breitflächig Schichten von Fichtenabfall liegen gelassen. Dies widerspricht nicht nur § 11 des Bundeswaldgesetz (BWaldG), sondern die unsachgemäße Forstwirtschaft gefährdet unmittelbar die Ortschaften Hubertshofen, Mistelbrunn, sowie Unterbränd durch Waldbrände.

Bruderbächle
Bruderbächle

Es wurden keine Ziele des Naturschutzes und der Landschaftspflege berücksichtigt, deshalb ist die forstliche Bodennutzung dort als Eingriff anzusehen § 14 (2) (BNatSchG).

Nach § 5 (2) (BNatSchG) sollen folgenden Grundsätze der guten fachlichen Praxis beachtet werden:

1. die Bewirtschaftung muss standortangepasst erfolgen und die nachhaltige Bodenfruchtbarkeit und langfristige Nutzbarkeit der Flächen muss gewährleistet werden;

2. die natürliche Ausstattung der Nutzfläche (Boden, Wasser, Flora, Fauna) darf nicht über das zur Erzielung eines nachhaltigen Ertrages erforderliche Maß hinaus beeinträchtigt werden;

Nach § 11 BWaldG soll der Wald im Rahmen seiner Zweckbestimmung ordnungsgemäß und nachhaltig bewirtschaftet werden. Dies ist im Forst auf der Gemarkung Mistelbrunn nicht ansatzweise zu erkennen.

update 13.05.2019

Mountaintop removal

In Kentucky gibt es ein „mountaintop removal“. Damit ist gemeint, wenn man die Bergspitze wegsprengt um an die Kohle zu gelangen. Es erinnert mich stark an das was im FF Forst mit den Ameisenhügeln geschieht: Ein mountaintop removal. So zumindest sehen die noch lebenden Ameisenhügel aus. Hier eine relativ frischer „mountaintop removal“ vom 11. und 12. Mai 2019.

Ameisenhügel mit entfernter Spitze

..

und so sieht das ganze von oben aus

Es gibt im FF Forst aber nicht nur das mountaintop removal, sondern auch einige überfahrene und tote Haufen:

Daneben wird achtlos Holz und Ernteabfälle drauf geworfen:

Mysteriöser Tod nach mountaintop removal

Abschleifen der Bäche mit Molchen, Laich und Kaulquappen im Mai

Es werden nicht nur Waldameisen vernichtet, sondern auch andere Habitate sind einfach im Weg und werden kurzerhand zerstört.

Begehung mit dem Förster Tröndle vom FF Forst und Dr. Hans-Peter Straub vom Baurechts- und Naturschutzamt am 14. Mai 2019

Bei der Begehung hat sich herausgestellt, dass das Naturschutzamt § 44 BNatSchG für nicht sonderlich wichtig erachtet und dem Forst da einen Spielraum gewährt. Zur Erinnerung:

Die hügelbauenden Waldameisen gehören in Deutschland nach der Bundesartenschutzverordnung (BArtSchV) zu den besonders geschützten Tierarten. Dieser allgemeine Schutz ergibt sich aus § 44 (BNatSchG). Demnach dürfen sie nicht der Natur entnommen oder gar getötet werden. Jeder Eingriff in die Neststruktur ist strengstens untersagt.

Auf den oben genannten Flurstücken wurden mehrere Ameisenhügel überfahren oder Holz darauf abgelegt. Dr. Straub findet dies nicht sonderlich schlimm und Teil des forstwirschaftlichen Arbeitens.

Da in den Gräben noch lebende Molche gefunden wurden, ist auch dies nicht sonderlich schlimm.

Das „Mountaintop removal“ seien die randalierenden Kinder gewesen, die sich nur im FF Forst aufhalten. Laut Herr Dr. Straub weiß jeder der Söhne hat, dass die zu so etwas in der Lage wären. Vielleicht sollte man mal ein ernstes Wort mit der Mistelbrunner Landjugend wechseln?

Meine Umweltmeldung wurde also vom Naturschutz abgearbeitet und der Förster Tröndle wurde vom Amt für seine hervorragende Arbeit gelobt.

Dass man mir keine Rechnung vorgelegt hat, ist nur der deutlichen Gesetzeslage zu verdanken.

Ich werde dieses Kapitel auch erst mal schließen und den Forst weiter beobachten und hoffen, dass nun sorgfältiger gearbeitet wird.

Falls weiterhin Ameisenhügel zerstört werden, gibt es die Möglichkeit einer Strafanzeige.

.

.

.

.

Zitierte Gesetze vom Stand Mai 2019

Bundesnaturschutzgesetz

§ 14 (2) (BNatSchG)

Die land-, forst- und fischereiwirtschaftliche Bodennutzung ist nicht als Eingriff anzusehen, soweit dabei die Ziele des Naturschutzes und der Landschaftspflege berücksichtigt werden.

§ 5 (2) (BNatSchG)

Bei der landwirtschaftlichen Nutzung sind neben den Anforderungen, die sich aus den für die Landwirtschaft geltenden Vorschriften und aus § 17 Absatz 2 des Bundes-Bodenschutzgesetzes ergeben, insbesondere die folgenden Grundsätze der guten fachlichen Praxis zu beachten:

1.die Bewirtschaftung muss standortangepasst erfolgen und die nachhaltige Bodenfruchtbarkeit und langfristige Nutzbarkeit der Flächen muss gewährleistet werden;

2.die natürliche Ausstattung der Nutzfläche (Boden, Wasser, Flora, Fauna) darf nicht über das zur Erzielung eines nachhaltigen Ertrages erforderliche Maß hinaus beeinträchtigt werden;

§ 5 (3) (BNatSchG)
Bei der forstlichen Nutzung des Waldes ist das Ziel zu verfolgen, naturnahe Wälder aufzubauen und diese ohne Kahlschläge nachhaltig zu bewirtschaften. 2 Ein hinreichender Anteil standortheimischer Forstpflanzen ist einzuhalten.


§ 44 (1) (BNatSchG)
Es ist verboten,1. wild lebenden Tieren der besonders geschützten Arten nachzustellen, sie zu fangen, zu verletzen oder zu töten oder ihre Entwicklungsformen aus der Natur zu entnehmen, zu beschädigen oder zu zerstören,

2. wild lebende Tiere der streng geschützten Arten und der europäischen Vogelarten während der Fortpflanzungs-, Aufzucht-, Mauser-, Überwinterungs- und Wanderungszeiten erheblich zu stören; eine erhebliche Störung liegt vor, wenn sich durch die Störung der Erhaltungszustand der lokalen Population einer Art verschlechtert,

3. Fortpflanzungs- oder Ruhestätten der wild lebenden Tiere der besonders geschützten Arten aus der Natur zu entnehmen, zu beschädigen oder zu zerstören,

Tierschutzgesetz

§ 17 TierSchG

Mit Freiheitsstrafe bis zu drei Jahren oder mit Geldstrafe wird bestraft, wer

1. ein Wirbeltier ohne vernünftigen Grund tötet oder

2.einem Wirbeltier

a)aus Rohheit erhebliche Schmerzen oder Leiden oder

b)länger anhaltende oder sich wiederholende erhebliche Schmerzen oder Leiden zufügt.

Bundeswaldgesetz

§ 11 BWaldG

Bewirtschaftung des Waldes

(1) Der Wald soll im Rahmen seiner Zweckbestimmung ordnungsgemäß und nachhaltig bewirtschaftet werden. Durch Landesgesetz ist mindestens die Verpflichtung für alle Waldbesitzer zu regeln, kahlgeschlagene Waldflächen oder verlichtete Waldbestände in angemessener Frist

1.wieder aufzuforsten oder

2.zu ergänzen, soweit die natürliche Wiederbestockung unvollständig bleibt,

falls nicht die Umwandlung in eine andere Nutzungsart genehmigt worden oder sonst zulässig ist.

(2) Bei der Bewirtschaftung sollen

1.die Funktion des Waldes als Archiv der Natur- und Kulturgeschichte sowie

2.im Falle von Parkanlagen, Gartenanlagen und Friedhofsanlagen die denkmalpflegerischen Belange angemessen berücksichtigt werden.

.

.

.

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Arion vulgaris

Spanische Wegschnecke







Wie die 16S rDNA sequenziert wurde bitte hier schauen.

Arion_vulgaris|05|42AF12
TCTCTCTATTAGGTAAGTCTGCCCGGTGATTTTTTTTAACGGCCGCAGTACTTTGACTGTGCTAAGGTAGCAAAATAAATAGGCTTATAATTAAGGTCGGGTATGAATGAACTAATGGGAGGAAGCTGTCTCTTTTGATTAGAACTACATTATTTTATAGGTGATTTCGCTTAGAGAGCGTATATACACAAGTGTACCTTAGAAACTTGTTATTCTTTTTGTGGGGGGGGAGAATTGCGGTTAATATGCCCGTGGCTATTTGACCTTAACTGATTAT

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Cepaea nemoralis

Hain Schnirkelschnecke

Wie die 16S rDNA sequenziert wurde bitte hier schauen.


Voucher 07
Voucher 07


.

.

.

Voucher 07

.


>07|Cepaea nemoralis|42AF11
TTCTGCTCCATGGTATGCTAAATAGCCGCAGTACTCTGACTGTGCAAAGGTAGCATAATAATTTGGCTTATAATTGAAGTCTGGTATGAAAGAACTAATGGGAGGTAGCTGTCTCCAGGGTATTAGTACTAAATTAGTAAGTAAGTGAAAATACTTACAGAGAGAAAATAGACGAGAAGACCCTAGAAGCTTGCTATTTGTTTTGTTGGGGCGACAGAATTGCATTTAAACCAATTTTATAGATGTGACGTAGAGCAGGAAAATTAAGCTACTCTAGGGATAACAGCATAATAAAATTTGTTTGTGACCTCGATGTTGGACTAGGTAGAATAGTCCTTAGAAGGGACTAAAAATGCTCTGTTCGAGCAGATTAACCTACATGATCTGAGTTCAGACCGG

Voucher 03

>03|Cepaea nemoralis|42AF08
TTCTGCTCCATGGTATGCTAAATAGCCGCAGTACTCTGACTGTGCAAAGGTAGCATAATAATTTGGCTTATAATTGAAGTCTGGTATGAAAGAACTAATGGGAGGTAGCTGTCTCCAGGGTATTAGTACTAAATTAGTAAGTAAGTGAAAATACTTACAGAGAGAAAATAGACGAGAAGACCCTAGAAGCTTGCTATTTGTTTTGTTGGGGCGACAGAATTGCATTTAAACCAATTTTATAGATGTGACGTAGAGCAGGAAAATTAAGCTACTCTAGGGATAACAGCATAATAAAATTTGTTTGTGACCTCGATGTTGGACTAGGTAGAATAGTCCTTAGAAGGGACTAAAAATGCTCTGTTCGAGCAGATTAACCTACATGATCTGAGTTCAGACCGG

.

.

.

.

.

Dieses Bild hat ein leeres alt-Attribut; sein Dateiname ist bloggergegentierversuche_2raine.gif.


Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


DNA Extraktion und 16S PCR Schnecken

22.02.2019

Malakazoologen sind diejenigen, die Schnecken bestimmen und untersuchen. Leider sind diese Zoologen bis heute eher Schnecken Leichenfledderer und „Häuslesammler“. Jetzt wollte ich aber unsere einheimischen Schnecken bestimmen und fotografieren, ohne diese irgendwie zu stören.
So kam mir die Idee, nach meinen umfassenden Untersuchungen mit dem Alpenveilchen, bei den Schnecken ebenso mit der DNA zu arbeiten.

Durch Recherche fand ich, dass es eine umfassende Datenbank auf NCBI gibt über das 16S als Marker für verschiedene Schnecken (1).

In meinem Labor benutze ich grundsätzlich keine giftigen Chemikalien wie Phenol, Mecaptoethanol oder Chloroform, die man normaler Weise zum Aufreinigen von DNA verwendet. Deshalb habe ich ein Protokoll entwickelt, das für Schnecken funktioniert ohne diese auf irgend eine Weise zu verletzten oder diese Chemikalien zu verwenden.

Ich habe ziemlich viel Zeit in dieses Protokoll investiert und will es hier gerne mit interessierten Menschen teilen.

Extraktion von DNA aus Schnecken ohne Phenol

Schnecke auf Swab

Ausgangsmaterial ist ein Abstrich mit einem Wattestab (Swab).

Hierbei wird sich die Schnecke zurück ziehen, das macht aber nichts.

Dann kommt der Kopf vom Swab in ein Eppi.

Je Eppi nehme ich 800 µl HS Buffer, plus 100 µl SDS (10%), plus 20 µl DTT, plus 40  µl Proteinase K und plus 20 µl RNAse.

HS Buffer

10 mM TrisHCl pH 7.6
10 mM KCl
10 mM MgCl2
400 mM NaCL
2 mM EDTA

Proteinase K

20 mg/ml in 100mM Tris pH 8,6, 6 mM CaCl2, 50% Glycerin. Lagern bei -20°C

DTT

5 g DTT in 32,4 ml H2O oder 1M. Bei  20°C lagern.

Das ganze wird vorsichtig gemischt und kommt bei 50°- 55°C für vier Stunden in den Heizblock. Ab- und an das Eppi bisschen bewegen.

Dann kommt das Eppi für 3 Minuten in die Zentrifuge mit Vollspeed. 700 µl vom Überstand kommen  mit 600 µl Isopropanol in ein neues Eppi und werden vorsichtig gemischt. Das alles bei Raumtemperatur! Dann wird die DNA 5 Minuten bei 12 K rpm abzentrifugiert. Nicht zu lange oder zu kalt, sonst kommt unerwünschtes irgendwas mit.

Danach kann man das Pellet 2 x mit 70% EtOH waschen, trocknen und in 20 µl TE oder H2O auflösen.

Falls die PCR später nicht funktioniert, kann das am ehesten an der DNA liegen. Natürlich nur, wenn man sich mit den Primern sicher ist. Hier empfiehlt sich eine positiv Kontrolle. Probleme mit der DNA kommt oft von der Proteinase K. Meiner Erfahrung nach kann man da mit der Konzentration und der Verdauzeit eher hoch gehen, als runter.  Wichtig ist auch ein guter RNA Verdau. RNA kann auch die PCR stören.


PCR der 16S mitochondrialen rDNA von Schnecken

16S Produkt ist etwa 400 bp groß

Die Primer sind alt bekannt und wurden 1991 von Palumbi veröffentlicht (2). Ich habe sie allerdings etwas modifiziert:

HM103f – CGCCTGTTTATCAAAAACAT
HM104r – CCGGTCTGAACTCAGAT

PCR: 30 cycles mit annealing 54°C und Phusion Taq (NEB)

Die Bande wird ausgeschnitten, mit dem Monarch DNA kit von New England Labs aufgereinigt, bei GATC in Köln mit Primer HM103 sequenziert und die Sequenz mit NCBI Blast abgeglichen.

Hier das Ergebnis mit meinem ersten Versuch, der oben abgebildeten Posthornschnecke.


(1) Razkin et al., Molecular phylogeny of the western Palaearctic Helicoidea (Gastropoda, Stylommatophora). Molecular Phylogenetics and Evolution, Volume 83, Pages 99-117 (2015)

(2) Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., The Simple Fool’s Guide to PCR, Version 2.0. Department of Zoology, University of Hawaii, Honolulu, HI. (1991)

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.