Ein forensischer Ansatz zur Bestimmung von Pelz-Decor

14.04.2015 / 21.08.2016 aktualisiert

Normalerweise beschäftigt sich die Forensik hauptsächlich mit Verbrechen rund um den Menschen und menschlicher DNA. Seit der VERORDNUNG DES EUROPÄISCHEN PARLAMENTS UND DES RATES über ein Verbot des Inverkehrbringens sowie der Ein- und Ausfuhr von Katzen- und Hundefellen sowie von Produkten, die solche Felle enthalten, in die bzw. aus der Gemeinschaft und deren Inkrafttreten am 01.01.2009, wird Katzen- und Hundefell gerne als Kaninchenfell oder auch als „fake fur“ falsch deklariert.

Das Europäische Parlament hat schon im Vorfeld der Verordnung die Problematik erkannt: Da Felle von Katzen und Hunden außerdem billiger sind als andere Pelzarten und als Ersatz für teurere Pelzarten genutzt werden können, stellt dies einen Anreiz zu unlauteren oder betrügerischen Praktiken dar; hierzu zählen falsche oder irreführende Angaben bei der Etikettierung ebenso wie andere Praktiken, die verschleiern sollen, um welche Produkte es sich eigentlich handelt und woher sie stammen. (1)

GESAMTEINFUHREN GEGERBTER PELZFELLE IN DIE EU-25-LÄNDER in Tonnen (1)

Jahr

Gesamteinfuhren

Aus China

Hauptausfuhrland

1998

3780,4

531,5

China

2005

4051,8

1295,6

China

GESAMTEINFUHREN VON BEKLEIDUNG, BEKLEIDUNGSZUBEHÖR UND SONSTIGEN WAREN gemäß KN- Code 4303 IN DIE EU-25-LÄNDER in Tonnen (1)

Jahr

Gesamteinfuhren

Aus China

Hauptausfuhrland

1998

1985,5

890,2

China

2005

3001,6

2128

China

Um das Tier zu bestimmen, von dem das Fell stammt, gibt es verschiedene Möglichkeiten: Mikroskopie, DNA-Tests und die MALDI-TOF-Massenspektrometrie. Da die Felle im Handel meist gegerbt und gefärbt sind, ist eine Isolierung von mitochondrialer DNA eine Herausforderung. Es gibt inzwischen aber viel Erfahrung mit antiker DNA und auch mit verarbeitetem Pelz. Gerade aus Italien, wo der Handel mit Pelzen schon lange strengen Verordnungen unterliegt, gibt es sehr gute Veröffentlichungen. So im Jahre 2014 von Pilli et al.: Pet fur or fake fur? A forensic approach (2).

IMG_2103

Da man zur Massenspektrometrie ein teures Gerät benötigt, habe ich mich hier auf die Mikroskopie und DNA-Tests beschränkt.

Mikroskopische Aufnahmen von Tierhaaren

IMG_0272

Kaninchenhaare

rabbit

Kaninchenhaare

 

 

 

 

 

 

cat

Katzenhaar

cat

Katzenhaar

 

 

 

 

 

 

Lara2

Hundehaar

Lara3

Hundehaar

 

 

 

 

 

 

IMG_0273

Pelzbesatz unbekannter Herkunft. (Kaninchen)

IMG_0270

Unbekannter Pelzbesatz von einem alten Schuh (Kaninchen)

 

fake 10er

Kunsthaar mit 100er Vergrößerung

rabbit 10er

Kaninchenhaar mit 100er Vergrößerung

 

 

 

 

 

 

 

 

 

 

 

 

PCR mit Tierhaaren

150323 cdr

Tierspezifische PCR
lane 1: Katze
lane 2: Hund
lane 3: Kaninchen

 

Bestimmung von tierspezifischen Abschnitten auf der mitochondrialen DNA (mtDNA).

Das amplifizierte Fragment aus mitochondrialer DNA  von Katzen ist 180 bp, von Hunden 153 bp und von Kaninchen 209 bp.

 

 

150323

lane 1: Marker
lane 2: Katzen DNA mit Katzenprimer
lane 3: Hunde DNA mit Hundeprimer
lane 4: Kaninchen DNA mit Katzenprimer
lane 5: Kaninchen DNA 1. PCR Kaninchenprimer
lane 6: Kaninchen DNA mit Hundeprimer
lane 7: Kaninchen DNA Kaninchenprimer 1. PCR
lane 8: Kaninchen DNA aus lane 7 und 2. PCR mit nested Kaninchenprimer

 

 

 

Da die Größenunterschiede in einem Agarosegel schlecht zu sehen sind, habe ich auch noch ein Polyacryamidgel gemacht.

PAC

PCR mit verschiedenen Tierhaaren
lane1: Größenmarker
lane2: Katzenhaar
lane3: Hundehaar
lane4: Katzenhaar
lane5: Haar von altem Schuh
lane6: Kaninchenhaar
lane7-9: Hundehaar

Wie gut diese Methode bei weiteren gegerbten und gefärbten Tierhaaren funktioniert, wird die Zukunft zeigen.

Untersuchung einer Kette mit angeblichem Kunstpelz

Diese Kette mit Pelzbesatz wurde als Kunstpelz verkauft.

CIMG6564

Kette mit angeblichem Kunstpelz

xy3 10

100er Vergrößerung zeigt, dass es sich um Echtpelz handelt. (Katze)

xy2

Tierhaar unbekannt (400er Vergrößerung)

xy1

Tierhaar unbekannt (Katze)

 

 

 

 

 

 

Camus

Katzenhaar aus Unterwolle (400er Vergrößerung)

rabbit2

Kaninchenhaar (400er)

rabbit1

Kaninchenhaar (400er)

fake

Kunstpelz (400er)

Mit dem Fell  wurde eine PCR mit den Katzenprimern gemacht.

PCR

PCR zeigt in lane 3 ein Produkt mit 180 bp

Das Fell sieht nicht nur unter dem Mikroskop aus wie Katzenfell, die PCR bestätigt auch DNA von Katzen an dem Fell.

 

Material und Methoden

In forensischen Analysen haben sich mitochondriale DNA Marker durchgesetzt. Mitochondriale DNA (mtDNA) ist innerhalb einer Spezies sehr gut konserviert und es gibt pro Zelle mehrere Kopien. Auch besitzen Mitochondrien noch eine zusätzliche Proteinhülle, sodass ihre DNA besser vor Degradationen geschützt ist. Innerhalb der mtDNA benutzt man heute cytrochrome b oder cytochrome c oxidase Marker (2). Deshalb wurden hier für die PCR Primer benutzt, die zwischen 150 und 300 Basenpaare (bp) der mtDNA eine definierte Spezies erkennen.

Extraktion von mitochondrialer DNA

Da in meinem Labor grundsätzlich kein Phenol oder andere giftigen Chemikalien benutzt werden, habe ich mich für verschiedene Salzfällungen entschieden.

1-2 Tierhaare wurden in 400 µl Puffer HS (10 mM Tris pH7.6, 10 mM KCl, 10 mM MgCl, 0,4 M NaCl, 2 mM EDTA), 10 µl DTT (1M), 10 µl Proteinase K und 50 µl 10% SDS über Nacht bei 55°C inkubiert. Am nächsten Morgen wurde mit 300 µl NaCl (5M) für 20 Minuten bei 12000 rpm die 1. Salzfällung durchgeführt. Aus dem Überstand wurde die DNA mit Isopropanol ausgefällt und mit 70% EtOH gewaschen. Danach wurde die DNA für 1 Stunde mit RNAse behandelt und eine 2. Salzfällung mit 300 mM Natriumacetat für 1h bei -20°C und anschließender Zentrifugation bei 12000 rpm für 20 Minuten durchgeführt. Die DNA wurde anschließend mit EtOH ausgefällt und gewaschen.

Primer für die PCR

Hund mtDNA: GAACTAGGTCAGCCCGGTACTT und CGGAGCACCAATTATTAACGGC
Produkt: 153bp
Katze mtDNA:TTCTCAGGATATACCCTTGACA und GAAAGAGCCCATTGAGGAAATC
Produkt: 180bp
Kaninchen mtDNA: AATCAAATAACAACTAAGCTGTA und TATAAAGCACCGCCAAGT 1.PCR
AATCAAATAACAACTAAGCTGTA und GCCAAGTCCTTTGAGTTTTA 2. PCR
Produkt 209bp

Wer gerne zusätzliche Infos will, hat oder gerne darüber diskutiert, der ist in meinem Forum willkommen: http://www.dr-nepomuk.de/forum/

 

(1) DAS EUROPÄISCHE PARLAMENT UND DER RAT DER EUROPÄISCHEN UNION, gestützt auf den Vertrag zur Gründung der Europäischen Gemeinschaft, insbesondere auf die Artikel 95 und 133, auf Vorschlag der Kommission, nach Stellungnahme des Europäischen Wirtschafts- und Sozialausschusses, gemäß dem Verfahren des Artikels 251 EG-Vertrag5, HABEN FOLGENDE VERORDNUNG ERLASSEN: http://ec.europa.eu/food/animal/welfare/cat_dog_fur_proposal_de.pdf

(2) Pet fur or fake fur? A forensic approach: Elena Pilli, Rosario Casamassima, Stefania Vai, Antonio Virgili, Filippo Barni, Giancarlo D’Errico, Andrea Berti, Giampietro Lago, David Caramelli. Investigative Genetics 5:7 (2014)

Text und Fotos dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.

Schreibe einen Kommentar

Deine E-Mail-Adresse wird nicht veröffentlicht. Erforderliche Felder sind mit * markiert.

Wordpress Anti-Spam durch WP-SpamShield