DNA Extraktion und 16S PCR Schnecken

22.02.2019

Malakazoologen sind diejenigen, die Schnecken bestimmen und untersuchen. Leider sind diese Zoologen bis heute eher Schnecken Leichenfledderer und „Häuslesammler“. Jetzt wollte ich aber unsere einheimischen Schnecken bestimmen und fotografieren, ohne diese irgendwie zu stören.
So kam mir die Idee, nach meinen umfassenden Untersuchungen mit dem Alpenveilchen, bei den Schnecken ebenso mit der DNA zu arbeiten.

Durch Recherche fand ich, dass es eine umfassende Datenbank auf NCBI gibt über das 16S als Marker für verschiedene Schnecken (1).

In meinem Labor benutze ich grundsätzlich keine giftigen Chemikalien wie Phenol, Mecaptoethanol oder Chloroform, die man normaler Weise zum Aufreinigen von DNA verwendet. Deshalb habe ich ein Protokoll entwickelt, das für Schnecken funktioniert ohne diese auf irgend eine Weise zu verletzten oder diese Chemikalien zu verwenden.

Ich habe ziemlich viel Zeit in dieses Protokoll investiert und will es hier gerne mit interessierten Menschen teilen.

Extraktion von DNA aus Schnecken ohne Phenol

Schnecke auf Swab

Ausgangsmaterial ist ein Abstrich mit einem Wattestab (Swab).

Hierbei wird sich die Schnecke zurück ziehen, das macht aber nichts.

Dann kommt der Kopf vom Swab in ein Eppi.

Je Eppi nehme ich 800 µl HS Buffer, plus 100 µl SDS (10%), plus 20 µl DTT, plus 40  µl Proteinase K und plus 20 µl RNAse.

HS Buffer

10 mM TrisHCl pH 7.6
10 mM KCl
10 mM MgCl2
400 mM NaCL
2 mM EDTA

Proteinase K

20 mg/ml in 100mM Tris pH 8,6, 6 mM CaCl2, 50% Glycerin. Lagern bei -20°C

DTT

5 g DTT in 32,4 ml H2O oder 1M. Bei  20°C lagern.

Das ganze wird vorsichtig gemischt und kommt bei 50°- 55°C für vier Stunden in den Heizblock. Ab- und an das Eppi bisschen bewegen.

Dann kommt das Eppi für 3 Minuten in die Zentrifuge mit Vollspeed. 700 µl vom Überstand kommen  mit 600 µl Isopropanol in ein neues Eppi und werden vorsichtig gemischt. Das alles bei Raumtemperatur! Dann wird die DNA 5 Minuten bei 12 K rpm abzentrifugiert. Nicht zu lange oder zu kalt, sonst kommt unerwünschtes irgendwas mit.

Danach kann man das Pellet 2 x mit 70% EtOH waschen, trocknen und in 20 µl TE oder H2O auflösen.

Falls die PCR später nicht funktioniert, kann das am ehesten an der DNA liegen. Natürlich nur, wenn man sich mit den Primern sicher ist. Hier empfiehlt sich eine positiv Kontrolle. Probleme mit der DNA kommt oft von der Proteinase K. Meiner Erfahrung nach kann man da mit der Konzentration und der Verdauzeit eher hoch gehen, als runter.  Wichtig ist auch ein guter RNA Verdau. RNA kann auch die PCR stören.


PCR der 16S mitochondrialen rDNA von Schnecken

16S Produkt ist etwa 400 bp groß

Die Primer sind alt bekannt und wurden 1991 von Palumbi veröffentlicht (2). Ich habe sie allerdings etwas modifiziert:

HM103f – CGCCTGTTTATCAAAAACAT
HM104r – CCGGTCTGAACTCAGAT

PCR: 30 cycles mit annealing 54°C und Phusion Taq (NEB)

Die Bande wird ausgeschnitten, mit dem Monarch DNA kit von New England Labs aufgereinigt, bei GATC in Köln mit Primer HM103 sequenziert und die Sequenz mit NCBI Blast abgeglichen.

Hier das Ergebnis mit meinem ersten Versuch, der oben abgebildeten Posthornschnecke.


(1) Razkin et al., Molecular phylogeny of the western Palaearctic Helicoidea (Gastropoda, Stylommatophora). Molecular Phylogenetics and Evolution, Volume 83, Pages 99-117 (2015)

(2) Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., The Simple Fool’s Guide to PCR, Version 2.0. Department of Zoology, University of Hawaii, Honolulu, HI. (1991)

Text und Abbildungen dürfen unter den Bedingungen der Creative Commons Attribution Share-Alike license (CC-BY-SA) gerne ganz oder teilweise kopiert und zitiert werden.


Schreibe einen Kommentar

Deine E-Mail-Adresse wird nicht veröffentlicht. Erforderliche Felder sind mit * markiert.

Wordpress Anti-Spam durch WP-SpamShield